\
| Variant ID: vg1115823556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15823556 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )
CACTTAGTATGTTAGTACGGGGATGAAATTTGGTATAGGAAGACAGTAAAAACTAACTCTGTGTTGTACGGCAATAGTATGAACGTCTTGTAATGCTGCG[C/T]
CTTCAGGAGATGGACGAGATTGTCCTCTGTGGCTTGCGGATACTGGTCGAGCATTGCGACGTTTACTTTCTGAGGGTCGATGAATCCAGTATCGAAAACC
GGTTTTCGATACTGGATTCATCGACCCTCAGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAG[G/A]
CGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTAGTTTTTACTGTCTTCCTATACCAAATTTCATCCCCGTACTAACATACTAAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.10% | 11.50% | 3.68% | 0.72% | NA |
| All Indica | 2759 | 73.50% | 19.10% | 6.13% | 1.23% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 6.40% | 2.18% | 0.17% | NA |
| Indica II | 465 | 43.90% | 43.40% | 10.75% | 1.94% | NA |
| Indica III | 913 | 79.40% | 12.20% | 6.79% | 1.64% | NA |
| Indica Intermediate | 786 | 70.90% | 22.40% | 5.60% | 1.15% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115823556 | C -> T | LOC_Os11g27500.1 | missense_variant ; p.Ala44Thr; MODERATE | nonsynonymous_codon ; A44T | Average:34.407; most accessible tissue: Minghui63 young leaf, score: 66.656 | benign |
0.572 |
DELETERIOUS | 0.01 |
| vg1115823556 | C -> DEL | LOC_Os11g27500.1 | N | frameshift_variant | Average:34.407; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115823556 | NA | 6.91E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 4.82E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 7.14E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 7.50E-09 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 1.12E-06 | mr1295_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 6.94E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 8.62E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 1.94E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 4.75E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | 9.90E-07 | 9.92E-07 | mr1500_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 4.03E-06 | mr1500_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 2.05E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 2.20E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 3.19E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 4.02E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | NA | 7.25E-06 | mr1824_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115823556 | 5.00E-06 | 5.02E-06 | mr1956_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |