\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115823556:

Variant ID: vg1115823556 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15823556
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTAGTATGTTAGTACGGGGATGAAATTTGGTATAGGAAGACAGTAAAAACTAACTCTGTGTTGTACGGCAATAGTATGAACGTCTTGTAATGCTGCG[C/T]
CTTCAGGAGATGGACGAGATTGTCCTCTGTGGCTTGCGGATACTGGTCGAGCATTGCGACGTTTACTTTCTGAGGGTCGATGAATCCAGTATCGAAAACC

Reverse complement sequence

GGTTTTCGATACTGGATTCATCGACCCTCAGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAG[G/A]
CGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTAGTTTTTACTGTCTTCCTATACCAAATTTCATCCCCGTACTAACATACTAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 11.50% 3.68% 0.72% NA
All Indica  2759 73.50% 19.10% 6.13% 1.23% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.30% 6.40% 2.18% 0.17% NA
Indica II  465 43.90% 43.40% 10.75% 1.94% NA
Indica III  913 79.40% 12.20% 6.79% 1.64% NA
Indica Intermediate  786 70.90% 22.40% 5.60% 1.15% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 12.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115823556 C -> T LOC_Os11g27500.1 missense_variant ; p.Ala44Thr; MODERATE nonsynonymous_codon ; A44T Average:34.407; most accessible tissue: Minghui63 young leaf, score: 66.656 benign 0.572 DELETERIOUS 0.01
vg1115823556 C -> DEL LOC_Os11g27500.1 N frameshift_variant Average:34.407; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115823556 NA 6.91E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 4.82E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 7.14E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 7.50E-09 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 1.12E-06 mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 6.94E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 8.62E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 1.94E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 4.75E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 9.90E-07 9.92E-07 mr1500_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 4.03E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 2.05E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 2.20E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 3.19E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 4.02E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 NA 7.25E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115823556 5.00E-06 5.02E-06 mr1956_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251