\
| Variant ID: vg1115788579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15788579 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.34, others allele: 0.00, population size: 277. )
AGGCCTTGATAACATGGCCAGGAAGGCTGGTATAGTTGTGAACAAGTACATGCTTCATTCTTTCTAAAGTATCCTCTCTTTCCAGATGCATACCCAGATT[G/A]
CCACACAACTTTGCATATTCTTGTGGTAGCTGTTGACCTTTACTTTTCAAGAATTGGGCTGTTGATACAAGGGCAAGTGGTAAACCATCACATTTAGTAC
GTACTAAATGTGATGGTTTACCACTTGCCCTTGTATCAACAGCCCAATTCTTGAAAAGTAAAGGTCAACAGCTACCACAAGAATATGCAAAGTTGTGTGG[C/T]
AATCTGGGTATGCATCTGGAAAGAGAGGATACTTTAGAAAGAATGAAGCATGTACTTGTTCACAACTATACCAGCCTTCCTGGCCATGTTATCAAGGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 35.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115788579 | G -> A | LOC_Os11g27430.1 | synonymous_variant ; p.Gly405Gly; LOW | synonymous_codon | Average:62.065; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115788579 | NA | 1.54E-25 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 7.97E-28 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 9.30E-43 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 9.31E-49 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 3.58E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | 9.32E-10 | 6.26E-105 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 2.78E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 1.39E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 3.98E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 1.49E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | 1.30E-17 | 5.21E-154 | mr1758_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115788579 | NA | 1.80E-31 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |