Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115688831:

Variant ID: vg1115688831 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15688831
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATAATCCTTCTCATATCCCTTGGATTCTTCATAAAGAAGATCCTCCGTTGGTTTCTATAATGCCTCTTAGTTGTCTAATCCCCGTGCTGTACCCATAAG[A/C]
ACCTCTGGTTTAGCGTGGTGCATCATATCTTCTAGACTGAATTCTGCCTCAAAATCGTCACTACTAGTCGAACCATCTTCATCCATTCTTTCAAGGGCCA

Reverse complement sequence

TGGCCCTTGAAAGAATGGATGAAGATGGTTCGACTAGTAGTGACGATTTTGAGGCAGAATTCAGTCTAGAAGATATGATGCACCACGCTAAACCAGAGGT[T/G]
CTTATGGGTACAGCACGGGGATTAGACAACTAAGAGGCATTATAGAAACCAACGGAGGATCTTCTTTATGAAGAATCCAAGGGATATGAGAAGGATTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.10%	9.40%	2.09%	64.43%	NA
All Indica	2759	1.90%	0.50%	0.65%	96.92%	NA
All Japonica	1512	63.90%	27.90%	5.16%	3.04%	NA
Aus	269	0.40%	0.00%	0.37%	99.26%	NA
Indica I	595	2.50%	0.50%	0.67%	96.30%	NA
Indica II	465	0.20%	0.60%	0.22%	98.92%	NA
Indica III	913	0.50%	0.20%	0.55%	98.69%	NA
Indica Intermediate	786	4.10%	0.80%	1.02%	94.15%	NA
Temperate Japonica	767	41.20%	49.20%	6.91%	2.74%	NA
Tropical Japonica	504	91.50%	2.20%	2.58%	3.77%	NA
Japonica Intermediate	241	78.40%	14.10%	4.98%	2.49%	NA
VI/Aromatic	96	91.70%	1.00%	0.00%	7.29%	NA
Intermediate	90	34.40%	6.70%	2.22%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115688831	A -> DEL	N	N	silent_mutation	Average:8.904; most accessible tissue: Callus, score: 34.974	N	N	N	N
vg1115688831	A -> C	LOC_Os11g27264.1	intron_variant ; MODIFIER	silent_mutation	Average:8.904; most accessible tissue: Callus, score: 34.974	N	N	N	N
vg1115688831	A -> C	LOC_Os11g27264.2	intron_variant ; MODIFIER	silent_mutation	Average:8.904; most accessible tissue: Callus, score: 34.974	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115688831	NA	3.26E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	1.11E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	1.73E-06	mr1162	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	1.02E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	5.00E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	7.44E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	9.18E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	3.38E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	8.30E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	4.67E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	3.47E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	5.27E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	4.11E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	9.33E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	3.77E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	1.36E-06	NA	mr1789	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	1.01E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	4.12E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	2.28E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	5.84E-07	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115688831	NA	1.11E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251