\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115582589:

Variant ID: vg1115582589 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15582589
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGTGATAATCGCCACAACCGCCGCGAACATGATAATCGCGAACAACGGGTGCCTGGCGATACTGGTCGAGGACGCCGACGCAATGATGATGACGACGG[A/G]
GATCAGCGCCAGAACAACAATGGTGGGCGGCGACAAGGTTCTCGAGAACCCGAGCGCACACCGGAACCGAGTGTAGACATCGGATAGACATCCGCGGAGG

Reverse complement sequence

CCTCCGCGGATGTCTATCCGATGTCTACACTCGGTTCCGGTGTGCGCTCGGGTTCTCGAGAACCTTGTCGCCGCCCACCATTGTTGTTCTGGCGCTGATC[T/C]
CCGTCGTCATCATCATTGCGTCGGCGTCCTCGACCAGTATCGCCAGGCACCCGTTGTTCGCGATTATCATGTTCGCGGCGGTTGTGGCGATTATCACGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 7.80% 1.95% 4.08% NA
All Indica  2759 97.50% 0.10% 0.72% 1.70% NA
All Japonica  1512 70.90% 21.60% 4.37% 3.17% NA
Aus  269 65.10% 0.00% 1.49% 33.46% NA
Indica I  595 96.10% 0.00% 1.34% 2.52% NA
Indica II  465 97.20% 0.00% 0.65% 2.15% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 95.80% 0.40% 1.15% 2.67% NA
Temperate Japonica  767 92.30% 1.70% 5.48% 0.52% NA
Tropical Japonica  504 39.10% 51.00% 2.38% 7.54% NA
Japonica Intermediate  241 69.30% 23.20% 4.98% 2.49% NA
VI/Aromatic  96 63.50% 32.30% 1.04% 3.12% NA
Intermediate  90 82.20% 11.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115582589 A -> DEL LOC_Os11g27060.1 N frameshift_variant Average:68.429; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N
vg1115582589 A -> G LOC_Os11g27060.1 synonymous_variant ; p.Gly268Gly; LOW synonymous_codon Average:68.429; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1115582589 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115582589 2.45E-06 NA mr1178 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589 NA 7.11E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589 NA 4.61E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589 NA 1.30E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589 NA 1.22E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251