Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1115582589:

Variant ID: vg1115582589 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15582589
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCGTGATAATCGCCACAACCGCCGCGAACATGATAATCGCGAACAACGGGTGCCTGGCGATACTGGTCGAGGACGCCGACGCAATGATGATGACGACGG[A/G]
GATCAGCGCCAGAACAACAATGGTGGGCGGCGACAAGGTTCTCGAGAACCCGAGCGCACACCGGAACCGAGTGTAGACATCGGATAGACATCCGCGGAGG

Reverse complement sequence

CCTCCGCGGATGTCTATCCGATGTCTACACTCGGTTCCGGTGTGCGCTCGGGTTCTCGAGAACCTTGTCGCCGCCCACCATTGTTGTTCTGGCGCTGATC[T/C]
CCGTCGTCATCATCATTGCGTCGGCGTCCTCGACCAGTATCGCCAGGCACCCGTTGTTCGCGATTATCATGTTCGCGGCGGTTGTGGCGATTATCACGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	7.80%	1.95%	4.08%	NA
All Indica	2759	97.50%	0.10%	0.72%	1.70%	NA
All Japonica	1512	70.90%	21.60%	4.37%	3.17%	NA
Aus	269	65.10%	0.00%	1.49%	33.46%	NA
Indica I	595	96.10%	0.00%	1.34%	2.52%	NA
Indica II	465	97.20%	0.00%	0.65%	2.15%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	95.80%	0.40%	1.15%	2.67%	NA
Temperate Japonica	767	92.30%	1.70%	5.48%	0.52%	NA
Tropical Japonica	504	39.10%	51.00%	2.38%	7.54%	NA
Japonica Intermediate	241	69.30%	23.20%	4.98%	2.49%	NA
VI/Aromatic	96	63.50%	32.30%	1.04%	3.12%	NA
Intermediate	90	82.20%	11.10%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115582589	A -> DEL	LOC_Os11g27060.1	N	frameshift_variant	Average:68.429; most accessible tissue: Zhenshan97 flag leaf, score: 86.673	N	N	N	N
vg1115582589	A -> G	LOC_Os11g27060.1	synonymous_variant ; p.Gly268Gly; LOW	synonymous_codon	Average:68.429; most accessible tissue: Zhenshan97 flag leaf, score: 86.673	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1115582589	A	G	0.0	0.0	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115582589	2.45E-06	NA	mr1178	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589	NA	7.11E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589	NA	4.61E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589	NA	1.30E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115582589	NA	1.22E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251