Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115520675:

Variant ID: vg1115520675 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15520675
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCACTAGTGTTGGTGAAATATGTGTATGCAGGTAATTTGAGGTGAAAACACATCCGTGATATGACAAAATGCACCTCTGCATATCCAGGACACGTTTACA[C/T]
GGATTAGAGGCTCCATAAGCCAATAAAAACCATTTAGAATTGGGCCAAAACATAGTGCAGGTTATTGGGGGCCCATTAAGCAACCTACCGGCCAAAGGAG

Reverse complement sequence

CTCCTTTGGCCGGTAGGTTGCTTAATGGGCCCCCAATAACCTGCACTATGTTTTGGCCCAATTCTAAATGGTTTTTATTGGCTTATGGAGCCTCTAATCC[G/A]
TGTAAACGTGTCCTGGATATGCAGAGGTGCATTTTGTCATATCACGGATGTGTTTTCACCTCAAATTACCTGCATACACATATTTCACCAACACTAGTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.30%	0.04%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	60.20%	39.00%	0.74%	0.00%	NA
Indica I	595	81.30%	18.70%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115520675	C -> T	LOC_Os11g26980.1	upstream_gene_variant ; 1102.0bp to feature; MODIFIER	silent_mutation	Average:35.354; most accessible tissue: Zhenshan97 young leaf, score: 50.669	N	N	N	N
vg1115520675	C -> T	LOC_Os11g26970.1	downstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:35.354; most accessible tissue: Zhenshan97 young leaf, score: 50.669	N	N	N	N
vg1115520675	C -> T	LOC_Os11g26970-LOC_Os11g26980	intergenic_region ; MODIFIER	silent_mutation	Average:35.354; most accessible tissue: Zhenshan97 young leaf, score: 50.669	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115520675	6.51E-06	NA	mr1154	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	1.03E-06	4.18E-06	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	1.57E-10	6.49E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	8.95E-10	1.75E-10	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	5.42E-08	NA	mr1102_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	6.33E-10	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	4.54E-10	1.86E-09	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	5.39E-08	NA	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115520675	NA	2.91E-06	mr1223_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251