\
| Variant ID: vg1115509243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15509243 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTGGTCAAGTACACCGCATTATCGAGGACGATCTCGACAAATGCAGAGTCGTCGTGCCCAACCTACCAACGAAGACCGATGACCTATCTCATAGCACCG[G/A]
CCATGGCTGGACTATTTGAGAAAAAGTTGTTAACGGATAATTCCTTGTGAACGTTGTCGGTTTGATCACCCGACATGATTGCGAACGGACATCCGGATAT
ATATCCGGATGTCCGTTCGCAATCATGTCGGGTGATCAAACCGACAACGTTCACAAGGAATTATCCGTTAACAACTTTTTCTCAAATAGTCCAGCCATGG[C/T]
CGGTGCTATGAGATAGGTCATCGGTCTTCGTTGGTAGGTTGGGCACGACGACTCTGCATTTGTCGAGATCGTCCTCGATAATGCGGTGTACTTGACCACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 59.90% | 40.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115509243 | G -> A | LOC_Os11g26956.1 | missense_variant ; p.Gly63Asp; MODERATE | nonsynonymous_codon ; G63D | Average:31.881; most accessible tissue: Zhenshan97 flower, score: 48.393 | possibly damaging |
1.88 |
DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115509243 | 4.67E-06 | NA | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 1.42E-06 | 8.36E-06 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 9.66E-06 | NA | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 1.19E-10 | 7.91E-13 | mr1097_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 2.93E-10 | 2.24E-10 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 7.01E-08 | NA | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 6.00E-10 | NA | mr1154_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 3.65E-10 | 4.67E-09 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | 5.22E-08 | NA | mr1223_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115509243 | NA | 1.19E-06 | mr1223_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |