\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115489572:

Variant ID: vg1115489572 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15489572
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATTGACATGGTTATGCATAAAAAGTGTATATTGATATTGGATTGTTTTTCGCCCGTTGCAACGCACGGGTATTTTTGCTAGTTACTATAAAGTTGAT[G/A]
CTCACTACTCTCCTAAAACTCAACATGTAAGTATGTCATATCATCACCCACAAGCAATATATTATTATCTAGAGTATTTTAAATCATATACAAGTATGTC

Reverse complement sequence

GACATACTTGTATATGATTTAAAATACTCTAGATAATAATATATTGCTTGTGGGTGATGATATGACATACTTACATGTTGAGTTTTAGGAGAGTAGTGAG[C/T]
ATCAACTTTATAGTAACTAGCAAAAATACCCGTGCGTTGCAACGGGCGAAAAACAATCCAATATCAATATACACTTTTTATGCATAACCATGTCAATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 30.40% 0.25% 1.48% NA
All Indica  2759 50.10% 46.90% 0.43% 2.54% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 60.20% 39.80% 0.00% 0.00% NA
Indica I  595 22.90% 77.00% 0.17% 0.00% NA
Indica II  465 62.60% 36.30% 0.65% 0.43% NA
Indica III  913 56.40% 38.10% 0.44% 5.04% NA
Indica Intermediate  786 56.10% 40.60% 0.51% 2.80% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115489572 G -> A LOC_Os11g26930.1 downstream_gene_variant ; 2344.0bp to feature; MODIFIER silent_mutation Average:30.719; most accessible tissue: Callus, score: 59.469 N N N N
vg1115489572 G -> A LOC_Os11g26940.1 downstream_gene_variant ; 2116.0bp to feature; MODIFIER silent_mutation Average:30.719; most accessible tissue: Callus, score: 59.469 N N N N
vg1115489572 G -> A LOC_Os11g26930-LOC_Os11g26940 intergenic_region ; MODIFIER silent_mutation Average:30.719; most accessible tissue: Callus, score: 59.469 N N N N
vg1115489572 G -> DEL N N silent_mutation Average:30.719; most accessible tissue: Callus, score: 59.469 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115489572 3.75E-07 2.80E-13 mr1097 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 3.32E-06 2.20E-08 mr1097 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 NA 2.82E-07 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 1.53E-07 NA mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 NA 1.45E-07 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 1.71E-09 2.60E-17 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 6.25E-08 1.35E-11 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 4.26E-07 NA mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 NA 1.11E-06 mr1102_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 NA 2.50E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 2.22E-10 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 2.35E-09 1.99E-14 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 7.35E-07 NA mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115489572 NA 4.84E-06 mr1223_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251