\
| Variant ID: vg1115487625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15487625 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 109. )
GGGACAAGTGGGTGGGTCCAACAGATGAGCACGTGGGGGAGGGGGAGGGACCGATTTTCCCACCTCCCCCGGTCAACCGATGCTGGGCATTCTCCTATAT[T/A]
AAGGGCACGGCTAAATCAATAATTAGCACACATTTAATGGGCCGGGTCAATGTTTGCTTGGCAAATCCAATATTACTATAAAGTTGATGCTCGCTACTTG
CAAGTAGCGAGCATCAACTTTATAGTAATATTGGATTTGCCAAGCAAACATTGACCCGGCCCATTAAATGTGTGCTAATTATTGATTTAGCCGTGCCCTT[A/T]
ATATAGGAGAATGCCCAGCATCGGTTGACCGGGGGAGGTGGGAAAATCGGTCCCTCCCCCTCCCCCACGTGCTCATCTGTTGGACCCACCCACTTGTCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 30.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 52.70% | 46.80% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.20% | 76.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 63.00% | 36.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 61.20% | 38.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 59.20% | 40.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115487625 | T -> A | LOC_Os11g26930.1 | downstream_gene_variant ; 397.0bp to feature; MODIFIER | silent_mutation | Average:68.316; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg1115487625 | T -> A | LOC_Os11g26940.1 | downstream_gene_variant ; 4063.0bp to feature; MODIFIER | silent_mutation | Average:68.316; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg1115487625 | T -> A | LOC_Os11g26930-LOC_Os11g26940 | intergenic_region ; MODIFIER | silent_mutation | Average:68.316; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115487625 | NA | 2.81E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 4.02E-12 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 1.73E-07 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 2.29E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 6.00E-07 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 6.48E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 8.21E-08 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 1.95E-08 | 3.71E-17 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 1.02E-07 | 6.65E-12 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 1.11E-07 | NA | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 9.37E-06 | 2.99E-07 | mr1102_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 1.03E-07 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 7.31E-09 | NA | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 6.00E-09 | 9.61E-15 | mr1154_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | 1.96E-07 | NA | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487625 | NA | 1.85E-06 | mr1223_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |