\
| Variant ID: vg1115487596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15487596 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 115. )
AGGTGAAACATCTTTTTGGAAAAAGGAGAGGGACAAGTGGGTGGGTCCAACAGATGAGCACGTGGGGGAGGGGGAGGGACCGATTTTCCCACCTCCCCCG[G/A]
TCAACCGATGCTGGGCATTCTCCTATATTAAGGGCACGGCTAAATCAATAATTAGCACACATTTAATGGGCCGGGTCAATGTTTGCTTGGCAAATCCAAT
ATTGGATTTGCCAAGCAAACATTGACCCGGCCCATTAAATGTGTGCTAATTATTGATTTAGCCGTGCCCTTAATATAGGAGAATGCCCAGCATCGGTTGA[C/T]
CGGGGGAGGTGGGAAAATCGGTCCCTCCCCCTCCCCCACGTGCTCATCTGTTGGACCCACCCACTTGTCCCTCTCCTTTTTCCAAAAAGATGTTTCACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 30.40% | 0.28% | 0.08% | NA |
| All Indica | 2759 | 52.60% | 46.80% | 0.47% | 0.14% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.00% | 76.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 63.00% | 36.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 61.00% | 38.20% | 0.55% | 0.22% | NA |
| Indica Intermediate | 786 | 58.90% | 40.50% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115487596 | G -> A | LOC_Os11g26930.1 | downstream_gene_variant ; 368.0bp to feature; MODIFIER | silent_mutation | Average:68.112; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| vg1115487596 | G -> A | LOC_Os11g26940.1 | downstream_gene_variant ; 4092.0bp to feature; MODIFIER | silent_mutation | Average:68.112; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| vg1115487596 | G -> A | LOC_Os11g26930-LOC_Os11g26940 | intergenic_region ; MODIFIER | silent_mutation | Average:68.112; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| vg1115487596 | G -> DEL | N | N | silent_mutation | Average:68.112; most accessible tissue: Zhenshan97 root, score: 78.04 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115487596 | NA | 6.63E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 8.76E-06 | 2.77E-12 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | NA | 1.08E-07 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | NA | 4.09E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | NA | 4.13E-07 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | NA | 1.25E-07 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 2.14E-08 | 6.41E-17 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 1.40E-07 | 1.32E-11 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 3.34E-08 | NA | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 2.14E-06 | 9.47E-08 | mr1102_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | NA | 1.87E-07 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 6.19E-09 | NA | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 3.65E-09 | 1.13E-14 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 1.21E-07 | NA | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115487596 | 6.99E-06 | 1.06E-06 | mr1223_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |