Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115484424:

Variant ID: vg1115484424 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15484424
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGCCCGAAGACCGGTCCTTATGGTGGCCGAGGTGCTCCTAGCAAAACCATGCACCTCGAGCCCAGCCTACAACCATTTAGGAGTTTGAATAGAGGGG[G/A]
AGGTGTGTGTTCAATTCCATCACAAGCCAACCATTCCATAATGTCCAAATGATATGAGAACTAATTAATCAGTTATAAAACCATCTAGTGTGGCATAATT

Reverse complement sequence

AATTATGCCACACTAGATGGTTTTATAACTGATTAATTAGTTCTCATATCATTTGGACATTATGGAATGGTTGGCTTGTGATGGAATTGAACACACACCT[C/T]
CCCCTCTATTCAAACTCCTAAATGGTTGTAGGCTGGGCTCGAGGTGCATGGTTTTGCTAGGAGCACCTCGGCCACCATAAGGACCGGTCTTCGGGCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	30.30%	0.44%	1.08%	NA
All Indica	2759	50.70%	46.70%	0.76%	1.85%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	60.60%	39.40%	0.00%	0.00%	NA
Indica I	595	23.20%	76.60%	0.00%	0.17%	NA
Indica II	465	62.20%	36.30%	0.65%	0.86%	NA
Indica III	913	57.80%	37.90%	1.31%	2.96%	NA
Indica Intermediate	786	56.50%	40.30%	0.76%	2.42%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115484424	G -> A	LOC_Os11g26930.1	upstream_gene_variant ; 1343.0bp to feature; MODIFIER	silent_mutation	Average:48.335; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1115484424	G -> A	LOC_Os11g26920-LOC_Os11g26930	intergenic_region ; MODIFIER	silent_mutation	Average:48.335; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1115484424	G -> DEL	N	N	silent_mutation	Average:48.335; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115484424	NA	6.83E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	3.51E-06	1.87E-12	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	7.17E-08	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	4.28E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	8.16E-07	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	5.12E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	7.48E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	3.29E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	8.25E-06	NA	mr1092_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	1.02E-07	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	5.72E-09	1.41E-17	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	3.68E-08	2.54E-12	mr1097_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	2.35E-08	NA	mr1102_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	1.92E-06	5.45E-08	mr1102_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	2.26E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	7.88E-09	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	5.87E-09	1.84E-14	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	4.90E-08	NA	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	3.30E-06	4.97E-07	mr1223_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115484424	NA	3.12E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251