Variant ID: vg1115480616 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 15480616 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
CCATCCTCCACCTTATATACCCCTTAGAACACCTATATCCTACCATGTTTTAGCATACTAGATCCTAACCGAAGCTCTGCGTCGAGTTTTACCTCGCCGT[A/T]
CCAAGCCGAGCACCGCCGCCCCCGCGCTGCTCTGTTCTTCGCCGCCACAAAGTTTTTCCGGCCGCAACCCGTCGTTTCAACCGATCTCGGTGAGTTCTTT
AAAGAACTCACCGAGATCGGTTGAAACGACGGGTTGCGGCCGGAAAAACTTTGTGGCGGCGAAGAACAGAGCAGCGCGGGGGCGGCGGTGCTCGGCTTGG[T/A]
ACGGCGAGGTAAAACTCGACGCAGAGCTTCGGTTAGGATCTAGTATGCTAAAACATGGTAGGATATAGGTGTTCTAAGGGGTATATAAGGTGGAGGATGG
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 83.90% | 12.90% | 1.78% | 1.48% | NA |
All Indica | 2759 | 75.30% | 19.60% | 2.57% | 2.54% | NA |
All Japonica | 1512 | 98.90% | 0.90% | 0.20% | 0.00% | NA |
Aus | 269 | 83.60% | 13.80% | 2.60% | 0.00% | NA |
Indica I | 595 | 94.50% | 1.80% | 3.70% | 0.00% | NA |
Indica II | 465 | 50.30% | 45.80% | 3.23% | 0.65% | NA |
Indica III | 913 | 80.50% | 13.70% | 0.88% | 4.93% | NA |
Indica Intermediate | 786 | 69.50% | 24.40% | 3.31% | 2.80% | NA |
Temperate Japonica | 767 | 99.20% | 0.50% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 16.70% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1115480616 | A -> T | LOC_Os11g26920.1 | upstream_gene_variant ; 4365.0bp to feature; MODIFIER | silent_mutation | Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
vg1115480616 | A -> T | LOC_Os11g26920-LOC_Os11g26930 | intergenic_region ; MODIFIER | silent_mutation | Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
vg1115480616 | A -> DEL | N | N | silent_mutation | Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1115480616 | 1.17E-06 | NA | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | 3.92E-07 | NA | mr1078 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 4.87E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 6.61E-12 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 3.99E-09 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 3.86E-10 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 4.16E-07 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 1.36E-10 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 1.10E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 9.99E-11 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115480616 | NA | 1.20E-06 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |