\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115480616:

Variant ID: vg1115480616 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15480616
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCCTCCACCTTATATACCCCTTAGAACACCTATATCCTACCATGTTTTAGCATACTAGATCCTAACCGAAGCTCTGCGTCGAGTTTTACCTCGCCGT[A/T]
CCAAGCCGAGCACCGCCGCCCCCGCGCTGCTCTGTTCTTCGCCGCCACAAAGTTTTTCCGGCCGCAACCCGTCGTTTCAACCGATCTCGGTGAGTTCTTT

Reverse complement sequence

AAAGAACTCACCGAGATCGGTTGAAACGACGGGTTGCGGCCGGAAAAACTTTGTGGCGGCGAAGAACAGAGCAGCGCGGGGGCGGCGGTGCTCGGCTTGG[T/A]
ACGGCGAGGTAAAACTCGACGCAGAGCTTCGGTTAGGATCTAGTATGCTAAAACATGGTAGGATATAGGTGTTCTAAGGGGTATATAAGGTGGAGGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 12.90% 1.78% 1.48% NA
All Indica  2759 75.30% 19.60% 2.57% 2.54% NA
All Japonica  1512 98.90% 0.90% 0.20% 0.00% NA
Aus  269 83.60% 13.80% 2.60% 0.00% NA
Indica I  595 94.50% 1.80% 3.70% 0.00% NA
Indica II  465 50.30% 45.80% 3.23% 0.65% NA
Indica III  913 80.50% 13.70% 0.88% 4.93% NA
Indica Intermediate  786 69.50% 24.40% 3.31% 2.80% NA
Temperate Japonica  767 99.20% 0.50% 0.26% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115480616 A -> T LOC_Os11g26920.1 upstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg1115480616 A -> T LOC_Os11g26920-LOC_Os11g26930 intergenic_region ; MODIFIER silent_mutation Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg1115480616 A -> DEL N N silent_mutation Average:48.259; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115480616 1.17E-06 NA mr1078 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 3.92E-07 NA mr1078 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 4.87E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 6.61E-12 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 3.99E-09 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 3.86E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 4.16E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 1.36E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 1.10E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 9.99E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480616 NA 1.20E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251