\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115479401:

Variant ID: vg1115479401 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15479401
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCGTAAGGACATTGTAACATCCTCAAATTTTAAAACTAAAATTTGACTGCATCATGCTGGCTTTTGATTAATTTAGTGTGTTTTAAAAATCTATTTG[A/C]
TTCCTAAGTGGTTCAAGTATTACTTCTTTAGAACCCTACTAATTTACCCTAATTATACCCTTTATTCCGAACCTTACTAAATTTGAGCAAATTCTCTCAA

Reverse complement sequence

TTGAGAGAATTTGCTCAAATTTAGTAAGGTTCGGAATAAAGGGTATAATTAGGGTAAATTAGTAGGGTTCTAAAGAAGTAATACTTGAACCACTTAGGAA[T/G]
CAAATAGATTTTTAAAACACACTAAATTAATCAAAAGCCAGCATGATGCAGTCAAATTTTAGTTTTAAAATTTGAGGATGTTACAATGTCCTTACGGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 30.30% 0.06% 1.80% NA
All Indica  2759 52.50% 44.30% 0.11% 3.08% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 84.40% 15.50% 0.00% 0.17% NA
Indica II  465 41.10% 57.60% 0.00% 1.29% NA
Indica III  913 39.00% 55.20% 0.22% 5.59% NA
Indica Intermediate  786 50.80% 45.70% 0.13% 3.44% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115479401 A -> DEL N N silent_mutation Average:30.274; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg1115479401 A -> C LOC_Os11g26920.1 upstream_gene_variant ; 3150.0bp to feature; MODIFIER silent_mutation Average:30.274; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg1115479401 A -> C LOC_Os11g26920-LOC_Os11g26930 intergenic_region ; MODIFIER silent_mutation Average:30.274; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115479401 6.16E-06 NA mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 3.77E-06 2.07E-08 mr1097 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 9.46E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 4.49E-06 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 1.34E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 2.00E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 3.28E-07 NA mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 3.23E-09 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 1.45E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 3.13E-08 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 1.16E-07 6.83E-13 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 6.89E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115479401 NA 2.54E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251