\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115457697:

Variant ID: vg1115457697 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15457697
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACAAGTTTCCATCTTCTAATATCTCATTTTCCGTAGCACGTTTTCCGAACTACTGAACAATGCAACTTTTTTGCAAAATAAAAACTTAAGTGAAATT[G/A]
TTTTTGAAAACTTATATTAATCCGGTTTCAAGTTTATTTAAGTTAAAACTTAGTTAATCATGTGCTAATGAGCCACCTCATTTTCCGTGTATGAAAGAGA

Reverse complement sequence

TCTCTTTCATACACGGAAAATGAGGTGGCTCATTAGCACATGATTAACTAAGTTTTAACTTAAATAAACTTGAAACCGGATTAATATAAGTTTTCAAAAA[C/T]
AATTTCACTTAAGTTTTTATTTTGCAAAAAAGTTGCATTGTTCAGTAGTTCGGAAAACGTGCTACGGAAAATGAGATATTAGAAGATGGAAACTTGTAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.50% 0.42% 0.06% NA
All Indica  2759 63.40% 35.90% 0.58% 0.07% NA
All Japonica  1512 98.30% 1.50% 0.13% 0.07% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 92.80% 7.10% 0.17% 0.00% NA
Indica II  465 49.20% 50.30% 0.43% 0.00% NA
Indica III  913 54.10% 45.30% 0.44% 0.11% NA
Indica Intermediate  786 60.40% 38.30% 1.15% 0.13% NA
Temperate Japonica  767 98.60% 1.20% 0.13% 0.13% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115457697 G -> A LOC_Os11g26900.1 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:39.724; most accessible tissue: Callus, score: 69.46 N N N N
vg1115457697 G -> A LOC_Os11g26910.1 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:39.724; most accessible tissue: Callus, score: 69.46 N N N N
vg1115457697 G -> A LOC_Os11g26900-LOC_Os11g26910 intergenic_region ; MODIFIER silent_mutation Average:39.724; most accessible tissue: Callus, score: 69.46 N N N N
vg1115457697 G -> DEL N N silent_mutation Average:39.724; most accessible tissue: Callus, score: 69.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115457697 NA 1.17E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 6.77E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 4.32E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 2.06E-14 mr1829 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 1.32E-10 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 3.26E-11 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 4.74E-06 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 4.47E-08 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 5.95E-13 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 3.54E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 3.55E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697 NA 1.78E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251