Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1115457697:

Variant ID: vg1115457697 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15457697
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACTACAAGTTTCCATCTTCTAATATCTCATTTTCCGTAGCACGTTTTCCGAACTACTGAACAATGCAACTTTTTTGCAAAATAAAAACTTAAGTGAAATT[G/A]
TTTTTGAAAACTTATATTAATCCGGTTTCAAGTTTATTTAAGTTAAAACTTAGTTAATCATGTGCTAATGAGCCACCTCATTTTCCGTGTATGAAAGAGA

Reverse complement sequence

TCTCTTTCATACACGGAAAATGAGGTGGCTCATTAGCACATGATTAACTAAGTTTTAACTTAAATAAACTTGAAACCGGATTAATATAAGTTTTCAAAAA[C/T]
AATTTCACTTAAGTTTTTATTTTGCAAAAAAGTTGCATTGTTCAGTAGTTCGGAAAACGTGCTACGGAAAATGAGATATTAGAAGATGGAAACTTGTAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	25.50%	0.42%	0.06%	NA
All Indica	2759	63.40%	35.90%	0.58%	0.07%	NA
All Japonica	1512	98.30%	1.50%	0.13%	0.07%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	92.80%	7.10%	0.17%	0.00%	NA
Indica II	465	49.20%	50.30%	0.43%	0.00%	NA
Indica III	913	54.10%	45.30%	0.44%	0.11%	NA
Indica Intermediate	786	60.40%	38.30%	1.15%	0.13%	NA
Temperate Japonica	767	98.60%	1.20%	0.13%	0.13%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115457697	G -> A	LOC_Os11g26900.1	upstream_gene_variant ; 2598.0bp to feature; MODIFIER	silent_mutation	Average:39.724; most accessible tissue: Callus, score: 69.46	N	N	N	N
vg1115457697	G -> A	LOC_Os11g26910.1	upstream_gene_variant ; 1762.0bp to feature; MODIFIER	silent_mutation	Average:39.724; most accessible tissue: Callus, score: 69.46	N	N	N	N
vg1115457697	G -> A	LOC_Os11g26900-LOC_Os11g26910	intergenic_region ; MODIFIER	silent_mutation	Average:39.724; most accessible tissue: Callus, score: 69.46	N	N	N	N
vg1115457697	G -> DEL	N	N	silent_mutation	Average:39.724; most accessible tissue: Callus, score: 69.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115457697	NA	1.17E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	6.77E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	4.32E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	2.06E-14	mr1829	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	1.32E-10	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	3.26E-11	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	4.74E-06	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	4.47E-08	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	5.95E-13	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	3.54E-08	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	3.55E-11	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115457697	NA	1.78E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251