\
| Variant ID: vg1115457697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15457697 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
ACTACAAGTTTCCATCTTCTAATATCTCATTTTCCGTAGCACGTTTTCCGAACTACTGAACAATGCAACTTTTTTGCAAAATAAAAACTTAAGTGAAATT[G/A]
TTTTTGAAAACTTATATTAATCCGGTTTCAAGTTTATTTAAGTTAAAACTTAGTTAATCATGTGCTAATGAGCCACCTCATTTTCCGTGTATGAAAGAGA
TCTCTTTCATACACGGAAAATGAGGTGGCTCATTAGCACATGATTAACTAAGTTTTAACTTAAATAAACTTGAAACCGGATTAATATAAGTTTTCAAAAA[C/T]
AATTTCACTTAAGTTTTTATTTTGCAAAAAAGTTGCATTGTTCAGTAGTTCGGAAAACGTGCTACGGAAAATGAGATATTAGAAGATGGAAACTTGTAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 25.50% | 0.42% | 0.06% | NA |
| All Indica | 2759 | 63.40% | 35.90% | 0.58% | 0.07% | NA |
| All Japonica | 1512 | 98.30% | 1.50% | 0.13% | 0.07% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 7.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 49.20% | 50.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 54.10% | 45.30% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 60.40% | 38.30% | 1.15% | 0.13% | NA |
| Temperate Japonica | 767 | 98.60% | 1.20% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115457697 | G -> A | LOC_Os11g26900.1 | upstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:39.724; most accessible tissue: Callus, score: 69.46 | N | N | N | N |
| vg1115457697 | G -> A | LOC_Os11g26910.1 | upstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:39.724; most accessible tissue: Callus, score: 69.46 | N | N | N | N |
| vg1115457697 | G -> A | LOC_Os11g26900-LOC_Os11g26910 | intergenic_region ; MODIFIER | silent_mutation | Average:39.724; most accessible tissue: Callus, score: 69.46 | N | N | N | N |
| vg1115457697 | G -> DEL | N | N | silent_mutation | Average:39.724; most accessible tissue: Callus, score: 69.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115457697 | NA | 1.17E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 6.77E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 4.32E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 2.06E-14 | mr1829 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 1.32E-10 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 3.26E-11 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | 4.74E-06 | NA | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 4.47E-08 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 5.95E-13 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 3.54E-08 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 3.55E-11 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115457697 | NA | 1.78E-07 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |