\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115386291:

Variant ID: vg1115386291 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15386291
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACCTAAAATCATAATATTAGTTGAACCAAAACAAGACTGTGTGAACCACACGAACATATATAAAAGTCTATATATGTTACTTCCTCCGTTTCACAAC[G/A]
TAAGTCATTCTAGCATTTTCCACATTCATATTGATGCTAATGAATCTAGATAGATATATGTGTTTAGATTCATTATCATCAATATGAATGTAGGAAATGC

Reverse complement sequence

GCATTTCCTACATTCATATTGATGATAATGAATCTAAACACATATATCTATCTAGATTCATTAGCATCAATATGAATGTGGAAAATGCTAGAATGACTTA[C/T]
GTTGTGAAACGGAGGAAGTAACATATATAGACTTTTATATATGTTCGTGTGGTTCACACAGTCTTGTTTTGGTTCAACTAATATTATGATTTTAGGTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 39.80% 0.06% 0.40% NA
All Indica  2759 40.50% 58.70% 0.11% 0.69% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 14.30% 85.20% 0.17% 0.34% NA
Indica II  465 54.40% 44.70% 0.00% 0.86% NA
Indica III  913 44.80% 54.40% 0.11% 0.66% NA
Indica Intermediate  786 47.20% 51.80% 0.13% 0.89% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115386291 G -> A LOC_Os11g26810-LOC_Os11g26830 intergenic_region ; MODIFIER silent_mutation Average:38.412; most accessible tissue: Callus, score: 62.768 N N N N
vg1115386291 G -> DEL N N silent_mutation Average:38.412; most accessible tissue: Callus, score: 62.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115386291 NA 3.60E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 8.70E-12 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 4.96E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 6.95E-11 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 5.85E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 1.00E-18 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 2.28E-09 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 2.19E-17 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 1.88E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 1.61E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 4.87E-08 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 4.31E-09 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 3.04E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 2.56E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 2.21E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 1.99E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 5.02E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115386291 NA 1.32E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251