\
| Variant ID: vg1115381015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15381015 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACCCATTTCACCTATATATATTATCCATCCCGCCTTCACCATTTGGTTTACAAACAAGGTACGTAGCATACGCATTCGCGCGGACATGTTTGTTATTTT[A/G]
CTTTGAAAACAGGTCTAACAAAATAAGTTTAACTTAAAGTGAGGTATTTCCCTTCTAAATTGAATGTTCATTGTTTAGTTTTTCTTAAAAATAACTTTAA
TTAAAGTTATTTTTAAGAAAAACTAAACAATGAACATTCAATTTAGAAGGGAAATACCTCACTTTAAGTTAAACTTATTTTGTTAGACCTGTTTTCAAAG[T/C]
AAAATAACAAACATGTCCGCGCGAATGCGTATGCTACGTACCTTGTTTGTAAACCAAATGGTGAAGGCGGGATGGATAATATATATAGGTGAAATGGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 8.80% | 1.21% | 1.63% | NA |
| All Indica | 2759 | 97.00% | 0.10% | 0.14% | 2.79% | NA |
| All Japonica | 1512 | 69.80% | 26.90% | 3.37% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.22% | 0.43% | NA |
| Indica III | 913 | 91.70% | 0.10% | 0.00% | 8.21% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 47.50% | 47.80% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 1.40% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 13.30% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115381015 | A -> DEL | N | N | silent_mutation | Average:38.927; most accessible tissue: Callus, score: 76.246 | N | N | N | N |
| vg1115381015 | A -> G | LOC_Os11g26810-LOC_Os11g26830 | intergenic_region ; MODIFIER | silent_mutation | Average:38.927; most accessible tissue: Callus, score: 76.246 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115381015 | NA | 1.29E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 1.77E-06 | mr1162 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 4.64E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 7.77E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 1.33E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 6.74E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 8.73E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 7.30E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 7.35E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 2.05E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 2.60E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 1.80E-07 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 1.31E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 3.44E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 2.08E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | 4.55E-06 | 8.42E-12 | mr1576_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 4.38E-07 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 5.20E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 3.60E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | 5.01E-06 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115381015 | NA | 2.76E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |