| Variant ID: vg1115373505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15373505 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATATTTTCCTTTTCCTCTGCCTCATGACATCAACTGGTTCGCCGTTGACTAGTGAGTCGAGGGCTACAGATGTTATATCATATTTTTTTCAACAATTTT[T/C,G]
ATAATATTTATCTTGATAGCTCGCGACATAATCTGAGTACAAAAGTGCCTATCGAGTTATGGAGTTTAATCTTTCTATGCTTTCCGTTTGGTTTACCAAT
ATTGGTAAACCAAACGGAAAGCATAGAAAGATTAAACTCCATAACTCGATAGGCACTTTTGTACTCAGATTATGTCGCGAGCTATCAAGATAAATATTAT[A/G,C]
AAAATTGTTGAAAAAAATATGATATAACATCTGTAGCCCTCGACTCACTAGTCAACGGCGAACCAGTTGATGTCATGAGGCAGAGGAAAAGGAAAATATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.10% | 8.70% | 21.67% | 44.35% | G: 0.13% |
| All Indica | 2759 | 2.10% | 0.80% | 25.81% | 71.11% | G: 0.22% |
| All Japonica | 1512 | 67.10% | 24.50% | 5.42% | 2.91% | NA |
| Aus | 269 | 0.70% | 4.10% | 74.72% | 20.45% | NA |
| Indica I | 595 | 2.90% | 0.00% | 16.81% | 80.34% | NA |
| Indica II | 465 | 1.10% | 1.30% | 35.91% | 61.72% | NA |
| Indica III | 913 | 0.40% | 0.90% | 27.05% | 71.08% | G: 0.55% |
| Indica Intermediate | 786 | 3.90% | 1.00% | 25.19% | 69.72% | G: 0.13% |
| Temperate Japonica | 767 | 46.00% | 43.50% | 7.17% | 3.26% | NA |
| Tropical Japonica | 504 | 93.10% | 1.20% | 2.98% | 2.78% | NA |
| Japonica Intermediate | 241 | 80.10% | 12.90% | 4.98% | 2.07% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 5.21% | 3.12% | NA |
| Intermediate | 90 | 28.90% | 8.90% | 26.67% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115373505 | T -> DEL | N | N | silent_mutation | Average:29.278; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1115373505 | T -> G | LOC_Os11g26810.1 | downstream_gene_variant ; 443.0bp to feature; MODIFIER | silent_mutation | Average:29.278; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1115373505 | T -> G | LOC_Os11g26810-LOC_Os11g26830 | intergenic_region ; MODIFIER | silent_mutation | Average:29.278; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1115373505 | T -> C | LOC_Os11g26810.1 | downstream_gene_variant ; 443.0bp to feature; MODIFIER | silent_mutation | Average:29.278; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1115373505 | T -> C | LOC_Os11g26810-LOC_Os11g26830 | intergenic_region ; MODIFIER | silent_mutation | Average:29.278; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115373505 | NA | 1.48E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 8.58E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 1.29E-07 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 1.68E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 8.58E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | 9.52E-07 | NA | mr1540_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 1.19E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | 1.68E-07 | NA | mr1732_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | 1.39E-06 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 9.78E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 9.35E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115373505 | NA | 3.21E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |