Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115345814:

Variant ID: vg1115345814 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15345814
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATATATGCTATATCGGTTTAGTGTCTCGAGGAGAAGATGATGACAGAGCGACACCACCTGTATTGGAAGGCGTTGGTTATACCGACCAATACATGTAA[T/C]
TTGTAATTATGGAAACTGATATGTGGATCCCACATGTAATGGGTGAGAACGACCATATGTGATCTCCTGGTTTACATGCAGGGCCGGTCCTGACTTTTTA

Reverse complement sequence

TAAAAAGTCAGGACCGGCCCTGCATGTAAACCAGGAGATCACATATGGTCGTTCTCACCCATTACATGTGGGATCCACATATCAGTTTCCATAATTACAA[A/G]
TTACATGTATTGGTCGGTATAACCAACGCCTTCCAATACAGGTGGTGTCGCTCTGTCATCATCTTCTCCTCGAGACACTAAACCGATATAGCATATATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	17.90%	1.23%	0.00%	NA
All Indica	2759	99.60%	0.20%	0.14%	0.00%	NA
All Japonica	1512	47.30%	49.60%	3.11%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.60%	0.38%	0.00%	NA
Temperate Japonica	767	76.90%	19.80%	3.26%	0.00%	NA
Tropical Japonica	504	7.10%	91.50%	1.39%	0.00%	NA
Japonica Intermediate	241	36.90%	56.80%	6.22%	0.00%	NA
VI/Aromatic	96	26.00%	71.90%	2.08%	0.00%	NA
Intermediate	90	73.30%	21.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115345814	T -> C	LOC_Os11g26790.1	upstream_gene_variant ; 1957.0bp to feature; MODIFIER	silent_mutation	Average:44.949; most accessible tissue: Callus, score: 80.869	N	N	N	N
vg1115345814	T -> C	LOC_Os11g26795.1	upstream_gene_variant ; 2017.0bp to feature; MODIFIER	silent_mutation	Average:44.949; most accessible tissue: Callus, score: 80.869	N	N	N	N
vg1115345814	T -> C	LOC_Os11g26790-LOC_Os11g26795	intergenic_region ; MODIFIER	silent_mutation	Average:44.949; most accessible tissue: Callus, score: 80.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115345814	NA	2.06E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	2.67E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	6.32E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	5.14E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	7.11E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.11E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.86E-13	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.15E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	9.95E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	8.33E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	5.71E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	3.60E-08	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	8.48E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	7.54E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	4.37E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	3.14E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	5.43E-11	mr1526_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	8.39E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	3.60E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	2.41E-15	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	4.74E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.06E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.97E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.36E-24	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.16E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115345814	NA	1.99E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251