\
| Variant ID: vg1115243061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15243061 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 63. )
TTATTTTTAATTCTGAATTTTTATTTGTCTTCCGAATATTAACTAAAATCGTATTGAGTTCTTATATTAACTCTTCTCTCAATATTTCTTATTTTTAATT[C/T]
CGAATTTCAGCTATTTTTGAATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTCTCTGATTAATGTGGGAATTTCTAGCCCCCACAGTGAACGTGGTGC
GCACCACGTTCACTGTGGGGGCTAGAAATTCCCACATTAATCAGAGAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATTCAAAAATAGCTGAAATTCG[G/A]
AATTAAAAATAAGAAATATTGAGAGAAGAGTTAATATAAGAACTCAATACGATTTTAGTTAATATTCGGAAGACAAATAAAAATTCAGAATTAAAAATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 35.00% | 1.12% | 2.07% | NA |
| All Indica | 2759 | 92.50% | 2.40% | 1.59% | 3.48% | NA |
| All Japonica | 1512 | 3.10% | 96.80% | 0.07% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 3.50% | 2.35% | 2.02% | NA |
| Indica II | 465 | 87.30% | 1.10% | 2.15% | 9.46% | NA |
| Indica III | 913 | 98.20% | 0.40% | 0.00% | 1.31% | NA |
| Indica Intermediate | 786 | 89.30% | 4.60% | 2.54% | 3.56% | NA |
| Temperate Japonica | 767 | 3.30% | 96.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 86.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 44.40% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115243061 | C -> T | LOC_Os11g26594.1 | downstream_gene_variant ; 3771.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1115243061 | C -> T | LOC_Os11g26600.1 | downstream_gene_variant ; 921.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1115243061 | C -> T | LOC_Os11g26594.2 | downstream_gene_variant ; 3793.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1115243061 | C -> T | LOC_Os11g26594-LOC_Os11g26600 | intergenic_region ; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1115243061 | C -> DEL | N | N | silent_mutation | Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115243061 | NA | 1.84E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115243061 | NA | 8.39E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115243061 | NA | 2.21E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115243061 | NA | 2.60E-10 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115243061 | 4.66E-06 | 8.26E-16 | mr1904_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |