\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115243061:

Variant ID: vg1115243061 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15243061
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTTTTAATTCTGAATTTTTATTTGTCTTCCGAATATTAACTAAAATCGTATTGAGTTCTTATATTAACTCTTCTCTCAATATTTCTTATTTTTAATT[C/T]
CGAATTTCAGCTATTTTTGAATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTCTCTGATTAATGTGGGAATTTCTAGCCCCCACAGTGAACGTGGTGC

Reverse complement sequence

GCACCACGTTCACTGTGGGGGCTAGAAATTCCCACATTAATCAGAGAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATTCAAAAATAGCTGAAATTCG[G/A]
AATTAAAAATAAGAAATATTGAGAGAAGAGTTAATATAAGAACTCAATACGATTTTAGTTAATATTCGGAAGACAAATAAAAATTCAGAATTAAAAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 35.00% 1.12% 2.07% NA
All Indica  2759 92.50% 2.40% 1.59% 3.48% NA
All Japonica  1512 3.10% 96.80% 0.07% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.10% 3.50% 2.35% 2.02% NA
Indica II  465 87.30% 1.10% 2.15% 9.46% NA
Indica III  913 98.20% 0.40% 0.00% 1.31% NA
Indica Intermediate  786 89.30% 4.60% 2.54% 3.56% NA
Temperate Japonica  767 3.30% 96.60% 0.00% 0.13% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 9.40% 86.50% 4.17% 0.00% NA
Intermediate  90 50.00% 44.40% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115243061 C -> T LOC_Os11g26594.1 downstream_gene_variant ; 3771.0bp to feature; MODIFIER silent_mutation Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1115243061 C -> T LOC_Os11g26600.1 downstream_gene_variant ; 921.0bp to feature; MODIFIER silent_mutation Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1115243061 C -> T LOC_Os11g26594.2 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1115243061 C -> T LOC_Os11g26594-LOC_Os11g26600 intergenic_region ; MODIFIER silent_mutation Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1115243061 C -> DEL N N silent_mutation Average:23.301; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115243061 NA 1.84E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115243061 NA 8.39E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115243061 NA 2.21E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115243061 NA 2.60E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115243061 4.66E-06 8.26E-16 mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251