\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115141729:

Variant ID: vg1115141729 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15141729
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCCTCAACGGAGTAGGAAACTGTCAGTGGACGAGCAATTCGCTTGTTTTGTTGAAGTAATCCAGAAGATCCACATCAACATGCTGTTGTTGGACGCTA[T/C]
GCAAGTACCAACATATGCCCGTTATCTCAAGGACATACTCAACAACAAGAGACCGCTCCCAACAACGGAGGTGGTCAAGCTGATGGAGCACTGCAGCAAT

Reverse complement sequence

ATTGCTGCAGTGCTCCATCAGCTTGACCACCTCCGTTGTTGGGAGCGGTCTCTTGTTGTTGAGTATGTCCTTGAGATAACGGGCATATGTTGGTACTTGC[A/G]
TAGCGTCCAACAACAGCATGTTGATGTGGATCTTCTGGATTACTTCAACAAAACAAGCGAATTGCTCGTCCACTGACAGTTTCCTACTCCGTTGAGGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 4.00% 15.45% 47.38% NA
All Indica  2759 7.90% 0.20% 22.15% 69.77% NA
All Japonica  1512 81.10% 11.70% 3.77% 3.44% NA
Aus  269 3.30% 0.00% 16.36% 80.30% NA
Indica I  595 5.00% 0.20% 19.16% 75.63% NA
Indica II  465 3.40% 0.00% 17.42% 79.14% NA
Indica III  913 11.40% 0.20% 26.40% 61.99% NA
Indica Intermediate  786 8.50% 0.40% 22.26% 68.83% NA
Temperate Japonica  767 94.10% 0.40% 1.96% 3.52% NA
Tropical Japonica  504 56.70% 33.70% 5.75% 3.77% NA
Japonica Intermediate  241 90.50% 1.70% 5.39% 2.49% NA
VI/Aromatic  96 86.50% 0.00% 7.29% 6.25% NA
Intermediate  90 38.90% 4.40% 12.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115141729 T -> DEL LOC_Os11g26440.1 N frameshift_variant Average:9.133; most accessible tissue: Callus, score: 34.024 N N N N
vg1115141729 T -> C LOC_Os11g26440.1 synonymous_variant ; p.Tyr448Tyr; LOW synonymous_codon Average:9.133; most accessible tissue: Callus, score: 34.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115141729 NA 1.52E-08 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 1.24E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 4.12E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 3.90E-06 3.90E-06 mr1345_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 1.34E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 5.91E-06 mr1386_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 1.47E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 5.55E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 1.88E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 7.06E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 3.56E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 2.99E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 2.58E-10 mr1632_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 8.33E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 4.76E-10 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 1.26E-09 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 7.30E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 8.63E-07 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 5.59E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 5.51E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 2.63E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729 NA 5.80E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251