Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1115141729:

Variant ID: vg1115141729 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15141729
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCCTCAACGGAGTAGGAAACTGTCAGTGGACGAGCAATTCGCTTGTTTTGTTGAAGTAATCCAGAAGATCCACATCAACATGCTGTTGTTGGACGCTA[T/C]
GCAAGTACCAACATATGCCCGTTATCTCAAGGACATACTCAACAACAAGAGACCGCTCCCAACAACGGAGGTGGTCAAGCTGATGGAGCACTGCAGCAAT

Reverse complement sequence

ATTGCTGCAGTGCTCCATCAGCTTGACCACCTCCGTTGTTGGGAGCGGTCTCTTGTTGTTGAGTATGTCCTTGAGATAACGGGCATATGTTGGTACTTGC[A/G]
TAGCGTCCAACAACAGCATGTTGATGTGGATCTTCTGGATTACTTCAACAAAACAAGCGAATTGCTCGTCCACTGACAGTTTCCTACTCCGTTGAGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	4.00%	15.45%	47.38%	NA
All Indica	2759	7.90%	0.20%	22.15%	69.77%	NA
All Japonica	1512	81.10%	11.70%	3.77%	3.44%	NA
Aus	269	3.30%	0.00%	16.36%	80.30%	NA
Indica I	595	5.00%	0.20%	19.16%	75.63%	NA
Indica II	465	3.40%	0.00%	17.42%	79.14%	NA
Indica III	913	11.40%	0.20%	26.40%	61.99%	NA
Indica Intermediate	786	8.50%	0.40%	22.26%	68.83%	NA
Temperate Japonica	767	94.10%	0.40%	1.96%	3.52%	NA
Tropical Japonica	504	56.70%	33.70%	5.75%	3.77%	NA
Japonica Intermediate	241	90.50%	1.70%	5.39%	2.49%	NA
VI/Aromatic	96	86.50%	0.00%	7.29%	6.25%	NA
Intermediate	90	38.90%	4.40%	12.22%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115141729	T -> DEL	LOC_Os11g26440.1	N	frameshift_variant	Average:9.133; most accessible tissue: Callus, score: 34.024	N	N	N	N
vg1115141729	T -> C	LOC_Os11g26440.1	synonymous_variant ; p.Tyr448Tyr; LOW	synonymous_codon	Average:9.133; most accessible tissue: Callus, score: 34.024	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115141729	NA	1.52E-08	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	1.24E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	4.12E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	3.90E-06	3.90E-06	mr1345_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	1.34E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	5.91E-06	mr1386_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	1.47E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	5.55E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	1.88E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	7.06E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	3.56E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	2.99E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	2.58E-10	mr1632_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	8.33E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	4.76E-10	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	1.26E-09	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	7.30E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	8.63E-07	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	5.59E-07	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	5.51E-06	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	2.63E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141729	NA	5.80E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251