\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115141419:

Variant ID: vg1115141419 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15141419
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGGTTGTGCTTCTGCTTTTCAAAATCAGCTGAGCTTTAACGAAATAATAGAAACCCAGCTAGCTCAGTTAGCATCCTTAGTCCTTGAAAATGAAACT[G/A]
GGAGGATTCCGAGGCAACCCGGCTCCTTCCTTGAAAATGTTAAAGCGATCACGACGAGGGAAGGTAAGTCCACTTGTGATCCGCCGTATCCTAATCCTGT

Reverse complement sequence

ACAGGATTAGGATACGGCGGATCACAAGTGGACTTACCTTCCCTCGTCGTGATCGCTTTAACATTTTCAAGGAAGGAGCCGGGTTGCCTCGGAATCCTCC[C/T]
AGTTTCATTTTCAAGGACTAAGGATGCTAACTGAGCTAGCTGGGTTTCTATTATTTCGTTAAAGCTCAGCTGATTTTGAAAAGCAGAAGCACAACCATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.10% 16.90% 10.30% 49.75% NA
All Indica  2759 12.60% 1.20% 13.45% 72.82% NA
All Japonica  1512 47.70% 43.80% 5.03% 3.51% NA
Aus  269 1.50% 0.70% 8.92% 88.85% NA
Indica I  595 4.90% 2.00% 16.81% 76.30% NA
Indica II  465 14.40% 0.20% 13.76% 71.61% NA
Indica III  913 17.20% 0.70% 11.61% 70.54% NA
Indica Intermediate  786 12.00% 1.70% 12.85% 73.54% NA
Temperate Japonica  767 80.80% 10.00% 5.48% 3.65% NA
Tropical Japonica  504 2.40% 91.70% 2.38% 3.57% NA
Japonica Intermediate  241 36.90% 51.00% 9.13% 2.90% NA
VI/Aromatic  96 3.10% 82.30% 6.25% 8.33% NA
Intermediate  90 17.80% 24.40% 11.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115141419 G -> A LOC_Os11g26440.1 missense_variant ; p.Gly370Arg; MODERATE nonsynonymous_codon ; G370R Average:12.036; most accessible tissue: Callus, score: 28.928 benign 0.672 TOLERATED 0.17
vg1115141419 G -> DEL LOC_Os11g26440.1 N frameshift_variant Average:12.036; most accessible tissue: Callus, score: 28.928 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115141419 NA 1.03E-08 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 3.94E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.82E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 5.43E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 3.01E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.20E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.64E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 3.50E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 4.31E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.53E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 9.17E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.92E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.27E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 6.89E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.14E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.78E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.30E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 5.44E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.94E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.05E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.49E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.68E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.59E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 7.40E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 3.22E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 5.11E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.58E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 3.64E-06 3.62E-06 mr1760_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 2.75E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 1.82E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115141419 NA 6.24E-09 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251