Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115110232:

Variant ID: vg1115110232 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15110232
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GAGACGGTGCAAACGGAGACGTTCCTACGACGATTTATAAAAGCGTCTCAGTTATCTGTAGGAGACGAGATAAAACGTCTCTATCCTACAAATAAGATGT[C/A]
TCCGTTGGGTTGTTTTGTTGTAGTCGCGCACCTCCTGCGAATAGTGGAAAGGTAGTTAGGGATGGCAACGGGGCGGGGCGGGGCTGGGTTGGGCTGGAAC

Reverse complement sequence

GTTCCAGCCCAACCCAGCCCCGCCCCGCCCCGTTGCCATCCCTAACTACCTTTCCACTATTCGCAGGAGGTGCGCGACTACAACAAAACAACCCAACGGA[G/T]
ACATCTTATTTGTAGGATAGAGACGTTTTATCTCGTCTCCTACAGATAACTGAGACGCTTTTATAAATCGTCGTAGGAACGTCTCCGTTTGCACCGTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	35.10%	1.48%	2.16%	NA
All Indica	2759	35.90%	58.20%	2.36%	3.59%	NA
All Japonica	1512	98.50%	1.20%	0.13%	0.13%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	21.80%	73.10%	3.53%	1.51%	NA
Indica II	465	9.70%	77.20%	5.16%	7.96%	NA
Indica III	913	58.50%	38.70%	0.55%	2.30%	NA
Indica Intermediate	786	35.80%	58.30%	1.91%	4.07%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	1.40%	0.40%	0.40%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	35.60%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115110232	C -> A	LOC_Os11g26380.1	upstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:40.966; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg1115110232	C -> A	LOC_Os11g26390.1	downstream_gene_variant ; 3903.0bp to feature; MODIFIER	silent_mutation	Average:40.966; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg1115110232	C -> A	LOC_Os11g26380-LOC_Os11g26390	intergenic_region ; MODIFIER	silent_mutation	Average:40.966; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg1115110232	C -> DEL	N	N	silent_mutation	Average:40.966; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115110232	NA	1.85E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115110232	5.46E-06	7.86E-06	mr1456	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115110232	NA	3.48E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115110232	NA	7.91E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115110232	NA	2.59E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251