\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115099731:

Variant ID: vg1115099731 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15099731
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTTTTCAACTATTGCATTTATTTTCGAATGTCATTGGGTGGAATTAAC[T/C]
TATTGTTTGTTATAGCCTTTTTGTTCTTGATTACCTTATTCCTTGATACCTTGGGTTATTATAACTTGACTAGTTGAGCTCTATATGTTGGTTCAACTAG

Reverse complement sequence

CTAGTTGAACCAACATATAGAGCTCAACTAGTCAAGTTATAATAACCCAAGGTATCAAGGAATAAGGTAATCAAGAACAAAAAGGCTATAACAAACAATA[A/G]
GTTAATTCCACCCAATGACATTCGAAAATAAATGCAATAGTTGAAAAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 0.20% 21.73% 3.62% NA
All Indica  2759 64.60% 0.30% 29.21% 5.94% NA
All Japonica  1512 98.50% 0.00% 1.26% 0.20% NA
Aus  269 29.70% 0.40% 69.89% 0.00% NA
Indica I  595 79.80% 0.30% 14.29% 5.55% NA
Indica II  465 72.50% 0.00% 15.48% 12.04% NA
Indica III  913 46.70% 0.20% 49.40% 3.72% NA
Indica Intermediate  786 69.20% 0.40% 25.19% 5.22% NA
Temperate Japonica  767 98.30% 0.00% 1.30% 0.39% NA
Tropical Japonica  504 99.00% 0.00% 0.99% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 81.10% 0.00% 14.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115099731 T -> DEL N N silent_mutation Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 N N N N
vg1115099731 T -> C LOC_Os11g26380.1 downstream_gene_variant ; 2314.0bp to feature; MODIFIER silent_mutation Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 N N N N
vg1115099731 T -> C LOC_Os11g26370-LOC_Os11g26380 intergenic_region ; MODIFIER silent_mutation Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115099731 NA 9.22E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 1.94E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 4.85E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 1.36E-35 mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 4.57E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 1.62E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731 NA 1.13E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251