\
| Variant ID: vg1115099731 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15099731 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTTTTCAACTATTGCATTTATTTTCGAATGTCATTGGGTGGAATTAAC[T/C]
TATTGTTTGTTATAGCCTTTTTGTTCTTGATTACCTTATTCCTTGATACCTTGGGTTATTATAACTTGACTAGTTGAGCTCTATATGTTGGTTCAACTAG
CTAGTTGAACCAACATATAGAGCTCAACTAGTCAAGTTATAATAACCCAAGGTATCAAGGAATAAGGTAATCAAGAACAAAAAGGCTATAACAAACAATA[A/G]
GTTAATTCCACCCAATGACATTCGAAAATAAATGCAATAGTTGAAAAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 0.20% | 21.73% | 3.62% | NA |
| All Indica | 2759 | 64.60% | 0.30% | 29.21% | 5.94% | NA |
| All Japonica | 1512 | 98.50% | 0.00% | 1.26% | 0.20% | NA |
| Aus | 269 | 29.70% | 0.40% | 69.89% | 0.00% | NA |
| Indica I | 595 | 79.80% | 0.30% | 14.29% | 5.55% | NA |
| Indica II | 465 | 72.50% | 0.00% | 15.48% | 12.04% | NA |
| Indica III | 913 | 46.70% | 0.20% | 49.40% | 3.72% | NA |
| Indica Intermediate | 786 | 69.20% | 0.40% | 25.19% | 5.22% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 1.30% | 0.39% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 14.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115099731 | T -> DEL | N | N | silent_mutation | Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 | N | N | N | N |
| vg1115099731 | T -> C | LOC_Os11g26380.1 | downstream_gene_variant ; 2314.0bp to feature; MODIFIER | silent_mutation | Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 | N | N | N | N |
| vg1115099731 | T -> C | LOC_Os11g26370-LOC_Os11g26380 | intergenic_region ; MODIFIER | silent_mutation | Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115099731 | NA | 9.22E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 1.94E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 4.85E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 1.36E-35 | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 4.57E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 1.62E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115099731 | NA | 1.13E-21 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |