Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1115099731:

Variant ID: vg1115099731 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15099731
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTTTTCAACTATTGCATTTATTTTCGAATGTCATTGGGTGGAATTAAC[T/C]
TATTGTTTGTTATAGCCTTTTTGTTCTTGATTACCTTATTCCTTGATACCTTGGGTTATTATAACTTGACTAGTTGAGCTCTATATGTTGGTTCAACTAG

Reverse complement sequence

CTAGTTGAACCAACATATAGAGCTCAACTAGTCAAGTTATAATAACCCAAGGTATCAAGGAATAAGGTAATCAAGAACAAAAAGGCTATAACAAACAATA[A/G]
GTTAATTCCACCCAATGACATTCGAAAATAAATGCAATAGTTGAAAAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	0.20%	21.73%	3.62%	NA
All Indica	2759	64.60%	0.30%	29.21%	5.94%	NA
All Japonica	1512	98.50%	0.00%	1.26%	0.20%	NA
Aus	269	29.70%	0.40%	69.89%	0.00%	NA
Indica I	595	79.80%	0.30%	14.29%	5.55%	NA
Indica II	465	72.50%	0.00%	15.48%	12.04%	NA
Indica III	913	46.70%	0.20%	49.40%	3.72%	NA
Indica Intermediate	786	69.20%	0.40%	25.19%	5.22%	NA
Temperate Japonica	767	98.30%	0.00%	1.30%	0.39%	NA
Tropical Japonica	504	99.00%	0.00%	0.99%	0.00%	NA
Japonica Intermediate	241	98.30%	0.00%	1.66%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	81.10%	0.00%	14.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115099731	T -> DEL	N	N	silent_mutation	Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677	N	N	N	N
vg1115099731	T -> C	LOC_Os11g26380.1	downstream_gene_variant ; 2314.0bp to feature; MODIFIER	silent_mutation	Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677	N	N	N	N
vg1115099731	T -> C	LOC_Os11g26370-LOC_Os11g26380	intergenic_region ; MODIFIER	silent_mutation	Average:14.881; most accessible tissue: Zhenshan97 flag leaf, score: 17.677	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115099731	NA	9.22E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	1.94E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	4.85E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	1.36E-35	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	4.57E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	1.62E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115099731	NA	1.13E-21	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251