\
| Variant ID: vg1115069932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15069932 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 94. )
TTTCATTTCATCTTCTATTTTAACATATACTTTAAAGTACAAATGTATAGTTCTATACTCTACGCTACTCCTAGTATAAAACCATAATAATCCAACCATA[T/C]
TTAAATTCACAATTCAAATTCGATTCTTTTAAAAAAAATAAAATGGAAATACAAATCCTAGTAGCATGTATTCATAGCTCGGGTGAAACGAGCTTCTGCT
AGCAGAAGCTCGTTTCACCCGAGCTATGAATACATGCTACTAGGATTTGTATTTCCATTTTATTTTTTTTAAAAGAATCGAATTTGAATTGTGAATTTAA[A/G]
TATGGTTGGATTATTATGGTTTTATACTAGGAGTAGCGTAGAGTATAGAACTATACATTTGTACTTTAAAGTATATGTTAAAATAGAAGATGAAATGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.50% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.30% | 19.20% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 66.50% | 32.50% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115069932 | T -> C | LOC_Os11g26320.1 | upstream_gene_variant ; 1098.0bp to feature; MODIFIER | silent_mutation | Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| vg1115069932 | T -> C | LOC_Os11g26330.1 | downstream_gene_variant ; 1387.0bp to feature; MODIFIER | silent_mutation | Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| vg1115069932 | T -> C | LOC_Os11g26320-LOC_Os11g26330 | intergenic_region ; MODIFIER | silent_mutation | Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115069932 | NA | 1.25E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 6.58E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 1.56E-06 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 3.70E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 8.67E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 7.00E-08 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 3.89E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 5.06E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 5.07E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | NA | 6.75E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115069932 | 4.64E-06 | NA | mr1904 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |