Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115069932:

Variant ID: vg1115069932 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15069932
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCATTTCATCTTCTATTTTAACATATACTTTAAAGTACAAATGTATAGTTCTATACTCTACGCTACTCCTAGTATAAAACCATAATAATCCAACCATA[T/C]
TTAAATTCACAATTCAAATTCGATTCTTTTAAAAAAAATAAAATGGAAATACAAATCCTAGTAGCATGTATTCATAGCTCGGGTGAAACGAGCTTCTGCT

Reverse complement sequence

AGCAGAAGCTCGTTTCACCCGAGCTATGAATACATGCTACTAGGATTTGTATTTCCATTTTATTTTTTTTAAAAGAATCGAATTTGAATTGTGAATTTAA[A/G]
TATGGTTGGATTATTATGGTTTTATACTAGGAGTAGCGTAGAGTATAGAACTATACATTTGTACTTTAAAGTATATGTTAAAATAGAAGATGAAATGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	6.50%	0.21%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.04%	0.00%	NA
All Japonica	1512	80.30%	19.20%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	66.50%	32.50%	1.04%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	83.40%	16.60%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115069932	T -> C	LOC_Os11g26320.1	upstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494	N	N	N	N
vg1115069932	T -> C	LOC_Os11g26330.1	downstream_gene_variant ; 1387.0bp to feature; MODIFIER	silent_mutation	Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494	N	N	N	N
vg1115069932	T -> C	LOC_Os11g26320-LOC_Os11g26330	intergenic_region ; MODIFIER	silent_mutation	Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115069932	NA	1.25E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	6.58E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	1.56E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	3.70E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	8.67E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	7.00E-08	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	3.89E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	5.06E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	5.07E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	NA	6.75E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932	4.64E-06	NA	mr1904	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251