\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115069932:

Variant ID: vg1115069932 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15069932
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCATTTCATCTTCTATTTTAACATATACTTTAAAGTACAAATGTATAGTTCTATACTCTACGCTACTCCTAGTATAAAACCATAATAATCCAACCATA[T/C]
TTAAATTCACAATTCAAATTCGATTCTTTTAAAAAAAATAAAATGGAAATACAAATCCTAGTAGCATGTATTCATAGCTCGGGTGAAACGAGCTTCTGCT

Reverse complement sequence

AGCAGAAGCTCGTTTCACCCGAGCTATGAATACATGCTACTAGGATTTGTATTTCCATTTTATTTTTTTTAAAAGAATCGAATTTGAATTGTGAATTTAA[A/G]
TATGGTTGGATTATTATGGTTTTATACTAGGAGTAGCGTAGAGTATAGAACTATACATTTGTACTTTAAAGTATATGTTAAAATAGAAGATGAAATGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.50% 0.21% 0.00% NA
All Indica  2759 99.40% 0.50% 0.04% 0.00% NA
All Japonica  1512 80.30% 19.20% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 66.50% 32.50% 1.04% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115069932 T -> C LOC_Os11g26320.1 upstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg1115069932 T -> C LOC_Os11g26330.1 downstream_gene_variant ; 1387.0bp to feature; MODIFIER silent_mutation Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg1115069932 T -> C LOC_Os11g26320-LOC_Os11g26330 intergenic_region ; MODIFIER silent_mutation Average:18.535; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115069932 NA 1.25E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 6.58E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 1.56E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 3.70E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 8.67E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 7.00E-08 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 3.89E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 5.06E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 5.07E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 NA 6.75E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115069932 4.64E-06 NA mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251