\
| Variant ID: vg1114989679 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14989679 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.19, others allele: 0.00, population size: 186. )
CATTCCTTGTCTTCACCATCTAGAGGGGGATATGTAGAAATATGAGAAAAATGAAGGAAAACAGGGGGCTTAGAAACTAATCTTTCTTATAAATTTAGGT[G/A]
CAATTATCTTAATCTTGATTAAAACACCGAAAAAGAGGCACGCAACTCCTAATTAAAGCAGCCATACCACTGACACATGATATCGACCGCCGACTAACCC
GGGTTAGTCGGCGGTCGATATCATGTGTCAGTGGTATGGCTGCTTTAATTAGGAGTTGCGTGCCTCTTTTTCGGTGTTTTAATCAAGATTAAGATAATTG[C/T]
ACCTAAATTTATAAGAAAGATTAGTTTCTAAGCCCCCTGTTTTCCTTCATTTTTCTCATATTTCTACATATCCCCCTCTAGATGGTGAAGACAAGGAATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 33.30% | 1.23% | 0.19% | NA |
| All Indica | 2759 | 98.10% | 1.30% | 0.54% | 0.04% | NA |
| All Japonica | 1512 | 3.20% | 93.60% | 2.65% | 0.53% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 95.40% | 2.80% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 3.60% | 87.90% | 6.94% | 1.59% | NA |
| Japonica Intermediate | 241 | 2.10% | 96.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 89.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114989679 | G -> A | LOC_Os11g26170.1 | upstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:33.809; most accessible tissue: Callus, score: 45.806 | N | N | N | N |
| vg1114989679 | G -> A | LOC_Os11g26180.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.809; most accessible tissue: Callus, score: 45.806 | N | N | N | N |
| vg1114989679 | G -> DEL | N | N | silent_mutation | Average:33.809; most accessible tissue: Callus, score: 45.806 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114989679 | NA | 1.05E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 8.62E-66 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.24E-75 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.21E-43 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.15E-49 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.74E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.83E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.25E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.72E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 3.88E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.45E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.38E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.06E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.45E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.91E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 6.20E-88 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 7.48E-67 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 2.43E-81 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.20E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | 8.35E-10 | 5.61E-106 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | 4.72E-06 | 4.72E-06 | mr1758 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.12E-17 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.99E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.69E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.69E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 2.74E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 3.72E-21 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 3.71E-39 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 5.42E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.46E-23 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 3.03E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 4.28E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.57E-22 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.04E-131 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.78E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 1.74E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114989679 | NA | 8.31E-41 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |