Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114908775:

Variant ID: vg1114908775 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14908775
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATGTTAATTATGTATGATTATTAGAATTTTTATCAAATTGAAATCATCCATATGCTAGTTATATATGATTATTAGAATTTTTAAAAGTTTTAAATCAT[G/A]
CACGTGGTATTTACATATGTTAATTAGAATTTTCAACAATTTATTATCATGATATGCTAATTATAATGACTATTAGAATTTTTATTAATTTTAAATCATG

Reverse complement sequence

CATGATTTAAAATTAATAAAAATTCTAATAGTCATTATAATTAGCATATCATGATAATAAATTGTTGAAAATTCTAATTAACATATGTAAATACCACGTG[C/T]
ATGATTTAAAACTTTTAAAAATTCTAATAATCATATATAACTAGCATATGGATGATTTCAATTTGATAAAAATTCTAATAATCATACATAATTAACATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	0.80%	5.82%	4.59%	NA
All Indica	2759	90.10%	0.00%	2.36%	7.47%	NA
All Japonica	1512	83.70%	2.40%	13.56%	0.26%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	83.20%	0.00%	3.70%	13.11%	NA
Indica II	465	83.00%	0.00%	3.44%	13.55%	NA
Indica III	913	98.70%	0.00%	0.44%	0.88%	NA
Indica Intermediate	786	89.70%	0.10%	2.93%	7.25%	NA
Temperate Japonica	767	72.40%	3.70%	23.47%	0.52%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	3.70%	10.37%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	90.00%	0.00%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114908775	G -> A	LOC_Os11g26050.1	upstream_gene_variant ; 3303.0bp to feature; MODIFIER	silent_mutation	Average:10.973; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114908775	G -> A	LOC_Os11g26060.1	upstream_gene_variant ; 1519.0bp to feature; MODIFIER	silent_mutation	Average:10.973; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114908775	G -> A	LOC_Os11g26070.1	intron_variant ; MODIFIER	silent_mutation	Average:10.973; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114908775	G -> DEL	N	N	silent_mutation	Average:10.973; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114908775	7.90E-06	2.44E-06	mr1700	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251