Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1114900915:

Variant ID: vg1114900915 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14900915
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACAAAAATCCTCTAAGCATTATTTGACTTTTAACTTTGCACATTTTAATTGTTGGAGGCTTTCACACGGTTTTTAATTATTCTAGGCATAATTTAGAGG[A/G]
TATATTTTAGGGTCGTTTTGGGACGCGACAAACCTACCCCCCTTAAACGGAATCTCGACCCCGAGATTCGGAAGAACTGGCGAAGAGATCGGGATGGGCT

Reverse complement sequence

AGCCCATCCCGATCTCTTCGCCAGTTCTTCCGAATCTCGGGGTCGAGATTCCGTTTAAGGGGGGTAGGTTTGTCGCGTCCCAAAACGACCCTAAAATATA[T/C]
CCTCTAAATTATGCCTAGAATAATTAAAAACCGTGTGAAAGCCTCCAACAATTAAAATGTGCAAAGTTAAAAGTCAAATAATGCTTAGAGGATTTTTGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	0.20%	4.95%	42.45%	NA
All Indica	2759	38.50%	0.10%	6.89%	54.44%	NA
All Japonica	1512	77.40%	0.30%	1.79%	20.50%	NA
Aus	269	39.80%	0.00%	4.46%	55.76%	NA
Indica I	595	28.60%	0.30%	4.03%	67.06%	NA
Indica II	465	31.00%	0.00%	6.67%	62.37%	NA
Indica III	913	49.80%	0.10%	9.86%	40.20%	NA
Indica Intermediate	786	37.40%	0.10%	5.73%	56.74%	NA
Temperate Japonica	767	64.50%	0.40%	2.61%	32.46%	NA
Tropical Japonica	504	96.40%	0.40%	0.40%	2.78%	NA
Japonica Intermediate	241	78.40%	0.00%	2.07%	19.50%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	55.60%	0.00%	5.56%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114900915	A -> DEL	N	N	silent_mutation	Average:13.506; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114900915	A -> G	LOC_Os11g26040.1	downstream_gene_variant ; 1966.0bp to feature; MODIFIER	silent_mutation	Average:13.506; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114900915	A -> G	LOC_Os11g26050.1	downstream_gene_variant ; 43.0bp to feature; MODIFIER	silent_mutation	Average:13.506; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114900915	A -> G	LOC_Os11g26060.1	downstream_gene_variant ; 4777.0bp to feature; MODIFIER	silent_mutation	Average:13.506; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1114900915	A -> G	LOC_Os11g26040-LOC_Os11g26050	intergenic_region ; MODIFIER	silent_mutation	Average:13.506; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114900915	3.36E-07	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	1.03E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	1.79E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	4.79E-06	NA	mr1315	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	4.94E-08	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	1.48E-07	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	1.85E-06	mr1398	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	5.18E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	5.02E-08	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	5.00E-06	5.00E-06	mr1464	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	1.87E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	6.94E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	2.14E-06	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	9.46E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114900915	NA	5.74E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251