\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114877299:

Variant ID: vg1114877299 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14877299
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAATCGACATCAACTCAGACGATAAATCAATCGGACGATGTCGAGAACCAGACTTGTGTGTGAATAGGCCAAGAACTCAGAATTGACACGATGAATT[A/G]
GGCCAAAATTCACAAGTCTACGGAGTGGAGCAATAGAGGAGGCCACCAGCCGAAATTAGGCTGGATTGGGCCAGCCCCAGGTTCGGCCGAACCAATCCTG

Reverse complement sequence

CAGGATTGGTTCGGCCGAACCTGGGGCTGGCCCAATCCAGCCTAATTTCGGCTGGTGGCCTCCTCTATTGCTCCACTCCGTAGACTTGTGAATTTTGGCC[T/C]
AATTCATCGTGTCAATTCTGAGTTCTTGGCCTATTCACACACAAGTCTGGTTCTCGACATCGTCCGATTGATTTATCGTCTGAGTTGATGTCGATTCTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 3.80% 31.97% 27.44% NA
All Indica  2759 5.20% 5.80% 45.31% 43.71% NA
All Japonica  1512 97.00% 0.30% 1.52% 1.26% NA
Aus  269 1.50% 5.60% 75.46% 17.47% NA
Indica I  595 6.20% 3.70% 26.05% 64.03% NA
Indica II  465 4.70% 5.60% 34.19% 55.48% NA
Indica III  913 1.80% 7.70% 64.29% 26.29% NA
Indica Intermediate  786 8.70% 5.30% 44.40% 41.60% NA
Temperate Japonica  767 96.90% 0.30% 1.04% 1.83% NA
Tropical Japonica  504 96.60% 0.40% 2.38% 0.60% NA
Japonica Intermediate  241 97.90% 0.00% 1.24% 0.83% NA
VI/Aromatic  96 90.60% 1.00% 5.21% 3.12% NA
Intermediate  90 42.20% 0.00% 33.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114877299 A -> DEL N N silent_mutation Average:22.424; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg1114877299 A -> G LOC_Os11g26010.1 3_prime_UTR_variant ; 1797.0bp to feature; MODIFIER silent_mutation Average:22.424; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg1114877299 A -> G LOC_Os11g26020.1 upstream_gene_variant ; 3285.0bp to feature; MODIFIER silent_mutation Average:22.424; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114877299 NA 2.79E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.74E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.29E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 6.06E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.36E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.97E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 7.63E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 5.25E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 5.43E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.31E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.10E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.74E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 3.21E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 3.04E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.11E-18 mr1376 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 4.22E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 6.23E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 7.95E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.11E-18 mr1431 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.00E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.23E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.49E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 6.53E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.79E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.33E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.88E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.87E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 5.11E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 7.65E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 1.06E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.62E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 9.45E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 4.67E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 4.67E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 2.62E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 8.24E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114877299 NA 5.76E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251