\
| Variant ID: vg1114877180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14877180 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAATATTACCAAAATAGGAGAGAACTAGTGATGCTTGCAATACATATGTTTGTTAGAATAATAATATTCCACTAGTATTAGGTTTACTAACCTTTTGCAG[A/T]
GAATGATCATAAAGTAGAGGAGAATCGACATCAACTCAGACGATAAATCAATCGGACGATGTCGAGAACCAGACTTGTGTGTGAATAGGCCAAGAACTCA
TGAGTTCTTGGCCTATTCACACACAAGTCTGGTTCTCGACATCGTCCGATTGATTTATCGTCTGAGTTGATGTCGATTCTCCTCTACTTTATGATCATTC[T/A]
CTGCAAAAGGTTAGTAAACCTAATACTAGTGGAATATTATTATTCTAACAAACATATGTATTGCAAGCATCACTAGTTCTCTCCTATTTTGGTAATATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.30% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 78.70% | 20.60% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 65.60% | 33.00% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114877180 | A -> T | LOC_Os11g26010.1 | 3_prime_UTR_variant ; 1678.0bp to feature; MODIFIER | silent_mutation | Average:23.866; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg1114877180 | A -> T | LOC_Os11g26020.1 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:23.866; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114877180 | 2.15E-06 | NA | mr1359 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114877180 | NA | 2.80E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114877180 | NA | 6.92E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114877180 | NA | 4.50E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114877180 | NA | 2.96E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114877180 | 2.10E-06 | NA | mr1904 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |