Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114870126:

Variant ID: vg1114870126 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14870126
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACACTATCAAGGGCGTCAGTCCCGACGCCGTCAGGCTGCGGCTGTTTCCGTTCTCCCTTCTCGGGAGAGCGAAGCAGTGGTTCTATGCCAACCATGCTG[C/T]
TGTCAACACCTGGGACAAATGCTCTACGGCATTCCTCTCGAAATTCTTCCCAATGGGCAAAACCAATGCTCTTCGTGGACGGATTTCTAGTTTCCAGCAG

Reverse complement sequence

CTGCTGGAAACTAGAAATCCGTCCACGAAGAGCATTGGTTTTGCCCATTGGGAAGAATTTCGAGAGGAATGCCGTAGAGCATTTGTCCCAGGTGTTGACA[G/A]
CAGCATGGTTGGCATAGAACCACTGCTTCGCTCTCCCGAGAAGGGAGAACGGAAACAGCCGCAGCCTGACGGCGTCGGGACTGACGCCCTTGATAGTGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	8.60%	5.67%	0.04%	NA
All Indica	2759	76.00%	14.60%	9.39%	0.07%	NA
All Japonica	1512	99.60%	0.10%	0.33%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	74.10%	7.20%	18.66%	0.00%	NA
Indica II	465	71.00%	18.30%	10.75%	0.00%	NA
Indica III	913	76.60%	19.10%	4.27%	0.11%	NA
Indica Intermediate	786	79.60%	12.70%	7.51%	0.13%	NA
Temperate Japonica	767	99.20%	0.10%	0.65%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114870126	C -> T	LOC_Os11g26000.1	missense_variant ; p.Ala100Val; MODERATE	nonsynonymous_codon ; A100I	Average:14.38; most accessible tissue: Minghui63 root, score: 23.574	benign	0.445	TOLERATED	0.09
vg1114870126	C -> T	LOC_Os11g26000.1	missense_variant ; p.Ala100Val; MODERATE	nonsynonymous_codon ; A100V	Average:14.38; most accessible tissue: Minghui63 root, score: 23.574	benign	0.261	TOLERATED	0.13
vg1114870126	C -> DEL	LOC_Os11g26000.1	N	frameshift_variant	Average:14.38; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114870126	5.28E-06	NA	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	2.88E-06	2.48E-08	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	9.54E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	3.94E-09	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	1.73E-06	NA	mr1129	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	6.84E-06	1.73E-11	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	6.35E-10	NA	mr1251	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	5.40E-09	2.53E-13	mr1251	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	1.01E-07	1.19E-18	mr1255	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	3.67E-06	5.92E-09	mr1255	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	5.11E-07	NA	mr1257	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	4.22E-06	6.97E-10	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	3.49E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	1.16E-06	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	4.06E-09	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	8.35E-09	NA	mr1435	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	4.47E-08	7.27E-12	mr1435	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	9.59E-08	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	4.03E-08	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	2.63E-09	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	5.18E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	9.02E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	2.24E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	2.97E-08	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	3.98E-09	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114870126	NA	2.39E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251