\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114869807:

Variant ID: vg1114869807 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14869807
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAACTTCAAAGAAAATCCAGAAGCTTTGTTCCGGAGCGTCAGGCCACGAGTCGTTGCTCCACAGAAAACTCTACCGACAAAGAAACCAGCCGTACCA[A/G]
CGCCACTGACCTTCAAGACAATGGCCAGCAAGACTCTTCGCGAGTTCGCTTTTCCCTCTGCTGACAATGTGGCCGTCGAGCCACAAGTCAACATAGGAGA

Reverse complement sequence

TCTCCTATGTTGACTTGTGGCTCGACGGCCACATTGTCAGCAGAGGGAAAAGCGAACTCGCGAAGAGTCTTGCTGGCCATTGTCTTGAAGGTCAGTGGCG[T/C]
TGGTACGGCTGGTTTCTTTGTCGGTAGAGTTTTCTGTGGAGCAACGACTCGTGGCCTGACGCTCCGGAACAAAGCTTCTGGATTTTCTTTGAAGTTTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 26.40% 32.04% 3.11% NA
All Indica  2759 21.40% 25.90% 47.84% 4.86% NA
All Japonica  1512 73.30% 23.40% 2.91% 0.33% NA
Aus  269 0.40% 54.30% 42.75% 2.60% NA
Indica I  595 21.20% 12.90% 61.34% 4.54% NA
Indica II  465 18.50% 16.30% 60.43% 4.73% NA
Indica III  913 22.50% 40.10% 32.42% 5.04% NA
Indica Intermediate  786 22.10% 24.80% 48.09% 4.96% NA
Temperate Japonica  767 60.20% 37.00% 2.35% 0.39% NA
Tropical Japonica  504 93.30% 2.00% 4.56% 0.20% NA
Japonica Intermediate  241 73.40% 24.90% 1.24% 0.41% NA
VI/Aromatic  96 84.40% 8.30% 7.29% 0.00% NA
Intermediate  90 41.10% 26.70% 31.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114869807 A -> DEL N N silent_mutation Average:13.224; most accessible tissue: Callus, score: 28.052 N N N N
vg1114869807 A -> G LOC_Os11g26000.1 upstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:13.224; most accessible tissue: Callus, score: 28.052 N N N N
vg1114869807 A -> G LOC_Os11g26010.1 upstream_gene_variant ; 4801.0bp to feature; MODIFIER silent_mutation Average:13.224; most accessible tissue: Callus, score: 28.052 N N N N
vg1114869807 A -> G LOC_Os11g25990-LOC_Os11g26000 intergenic_region ; MODIFIER silent_mutation Average:13.224; most accessible tissue: Callus, score: 28.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114869807 NA 1.21E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869807 NA 1.82E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869807 3.41E-06 NA mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869807 NA 3.33E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251