Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1114869505:

Variant ID: vg1114869505 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14869505
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGACGAACTCTGTAACCATAATATACCAGAAGTATTTCTGCGTTATTGCT[G/A]
GGAATTATATTTCTAGTAATGTCGTCAAGAAATACCAACAAGCATTTCTGGCGCCGTTGCCGGGGAAGATTCATAATAGACATTACTTGAACTAATACTT

Reverse complement sequence

AAGTATTAGTTCAAGTAATGTCTATTATGAATCTTCCCCGGCAACGGCGCCAGAAATGCTTGTTGGTATTTCTTGACGACATTACTAGAAATATAATTCC[C/T]
AGCAATAACGCAGAAATACTTCTGGTATATTATGGTTACAGAGTTCGTCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.40%	8.00%	36.27%	26.32%	NA
All Indica	2759	4.90%	1.30%	53.39%	40.45%	NA
All Japonica	1512	74.90%	22.20%	1.59%	1.39%	NA
Aus	269	1.10%	0.00%	65.80%	33.09%	NA
Indica I	595	4.70%	1.30%	33.61%	60.34%	NA
Indica II	465	6.70%	0.00%	55.70%	37.63%	NA
Indica III	913	3.00%	0.00%	69.55%	27.49%	NA
Indica Intermediate	786	6.10%	3.60%	48.22%	42.11%	NA
Temperate Japonica	767	61.30%	35.70%	1.17%	1.83%	NA
Tropical Japonica	504	95.80%	0.80%	2.18%	1.19%	NA
Japonica Intermediate	241	74.30%	23.70%	1.66%	0.41%	NA
VI/Aromatic	96	84.40%	6.20%	6.25%	3.12%	NA
Intermediate	90	43.30%	2.20%	37.78%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114869505	G -> A	LOC_Os11g26000.1	upstream_gene_variant ; 323.0bp to feature; MODIFIER	silent_mutation	Average:10.559; most accessible tissue: Callus, score: 30.184	N	N	N	N
vg1114869505	G -> A	LOC_Os11g25990-LOC_Os11g26000	intergenic_region ; MODIFIER	silent_mutation	Average:10.559; most accessible tissue: Callus, score: 30.184	N	N	N	N
vg1114869505	G -> DEL	N	N	silent_mutation	Average:10.559; most accessible tissue: Callus, score: 30.184	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114869505	7.89E-06	1.55E-07	mr1028	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	NA	1.55E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	NA	4.00E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	NA	3.05E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	9.77E-06	9.76E-06	mr1424	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	NA	3.69E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505	NA	4.25E-07	mr1453	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251