\
| Variant ID: vg1114869295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14869295 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )
TTATATTACCGCTGTATAATCATTTCCTTTGCAGGCTAACCTTGGTTGTTTTCACTTTTCGTTGTGAAAACAGGGTAGTGCATGACTGGTTTCAACCTGC[T/C]
GGAAAACTTCAAAGAAAATCCAGAAGCTTTCTTCCGGAGCTTCAGGCCGCAAGTCGTTGCTCCGCAGAAAACTCTACCGACACCCACGGGATAAAATAAA
TTTATTTTATCCCGTGGGTGTCGGTAGAGTTTTCTGCGGAGCAACGACTTGCGGCCTGAAGCTCCGGAAGAAAGCTTCTGGATTTTCTTTGAAGTTTTCC[A/G]
GCAGGTTGAAACCAGTCATGCACTACCCTGTTTTCACAACGAAAAGTGAAAACAACCAAGGTTAGCCTGCAAAGGAAATGATTATACAGCGGTAATATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 32.30% | 22.28% | 9.08% | NA |
| All Indica | 2759 | 4.20% | 53.10% | 29.61% | 13.08% | NA |
| All Japonica | 1512 | 97.20% | 0.70% | 1.52% | 0.60% | NA |
| Aus | 269 | 1.50% | 12.30% | 67.29% | 18.96% | NA |
| Indica I | 595 | 4.90% | 33.80% | 36.64% | 24.71% | NA |
| Indica II | 465 | 2.40% | 48.40% | 36.13% | 13.12% | NA |
| Indica III | 913 | 2.20% | 74.00% | 17.96% | 5.81% | NA |
| Indica Intermediate | 786 | 7.30% | 46.10% | 33.97% | 12.72% | NA |
| Temperate Japonica | 767 | 96.90% | 0.50% | 1.69% | 0.91% | NA |
| Tropical Japonica | 504 | 97.00% | 1.00% | 1.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 6.25% | 2.08% | NA |
| Intermediate | 90 | 44.40% | 20.00% | 28.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114869295 | T -> DEL | N | N | silent_mutation | Average:9.812; most accessible tissue: Callus, score: 42.522 | N | N | N | N |
| vg1114869295 | T -> C | LOC_Os11g26000.1 | upstream_gene_variant ; 533.0bp to feature; MODIFIER | silent_mutation | Average:9.812; most accessible tissue: Callus, score: 42.522 | N | N | N | N |
| vg1114869295 | T -> C | LOC_Os11g25990-LOC_Os11g26000 | intergenic_region ; MODIFIER | silent_mutation | Average:9.812; most accessible tissue: Callus, score: 42.522 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114869295 | 4.77E-08 | NA | mr1079 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 4.76E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 1.76E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 2.26E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 2.55E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | 6.88E-07 | NA | mr1390 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 2.55E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | 2.48E-06 | NA | mr1490 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | 9.96E-06 | 9.30E-90 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 9.47E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 8.55E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869295 | NA | 1.99E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |