\
| Variant ID: vg1114666752 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14666752 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )
TACCTAATGGTAGGTAGGTTAGAGAGGACTTTCTATGTGTTTTAACTATCTAAGCTAAGCAAAGATAATTTCCTATCTGTTGCTTCGGGCACCAACCCCT[A/G]
CTGGTCTGCCAGCGTGTTTCCGGCTATAGCTCTATGATGTACCCGAACGTGGAGGATTACTAGGACGGGATTCAGGGCTGTCACCACCTGCCACCTACCT
AGGTAGGTGGCAGGTGGTGACAGCCCTGAATCCCGTCCTAGTAATCCTCCACGTTCGGGTACATCATAGAGCTATAGCCGGAAACACGCTGGCAGACCAG[T/C]
AGGGGTTGGTGCCCGAAGCAACAGATAGGAAATTATCTTTGCTTAGCTTAGATAGTTAAAACACATAGAAAGTCCTCTCTAACCTACCTACCATTAGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 34.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.80% | 96.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.00% | 95.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114666752 | A -> G | LOC_Os11g25700.1 | downstream_gene_variant ; 2793.0bp to feature; MODIFIER | silent_mutation | Average:51.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg1114666752 | A -> G | LOC_Os11g25720.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114666752 | NA | 1.84E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 5.04E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.53E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.20E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 4.82E-78 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.91E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 2.07E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.09E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 2.51E-25 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.09E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 4.09E-86 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.37E-34 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 9.66E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | 5.01E-11 | 9.10E-108 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | 4.84E-06 | 4.84E-06 | mr1758 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 2.79E-21 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.03E-23 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.61E-18 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 1.29E-135 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114666752 | NA | 3.73E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |