\
| Variant ID: vg1114628121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14628121 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 104. )
TTGCAAGAAATCACCCACATCTTATGGAAACCCTCTATTAAGGGAATTCGTTCCATTTTTTTTCACCAAAAATGCTTCACCTAGTGTACTTATAATGTTT[C/T]
ACTATGTATGGATTAAATGTTGTAGTGAACTAAAACTTTTTTTCACTATTTGCTAAAATATTTTTTTTATATAAGGTGAAACTGCGCCCGATTTAAACGA
TCGTTTAAATCGGGCGCAGTTTCACCTTATATAAAAAAAATATTTTAGCAAATAGTGAAAAAAAGTTTTAGTTCACTACAACATTTAATCCATACATAGT[G/A]
AAACATTATAAGTACACTAGGTGAAGCATTTTTGGTGAAAAAAAATGGAACGAATTCCCTTAATAGAGGGTTTCCATAAGATGTGGGTGATTTCTTGCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.30% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 5.50% | 93.10% | 1.46% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 7.40% | 90.00% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 3.80% | 95.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114628121 | C -> T | LOC_Os11g25640.1 | downstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg1114628121 | C -> T | LOC_Os11g25640-LOC_Os11g25650 | intergenic_region ; MODIFIER | silent_mutation | Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114628121 | NA | 4.86E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 1.89E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 4.62E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 3.87E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 6.07E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 7.43E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | 6.33E-08 | 6.17E-08 | mr1648_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114628121 | NA | 2.56E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |