\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114628121:

Variant ID: vg1114628121 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14628121
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCAAGAAATCACCCACATCTTATGGAAACCCTCTATTAAGGGAATTCGTTCCATTTTTTTTCACCAAAAATGCTTCACCTAGTGTACTTATAATGTTT[C/T]
ACTATGTATGGATTAAATGTTGTAGTGAACTAAAACTTTTTTTCACTATTTGCTAAAATATTTTTTTTATATAAGGTGAAACTGCGCCCGATTTAAACGA

Reverse complement sequence

TCGTTTAAATCGGGCGCAGTTTCACCTTATATAAAAAAAATATTTTAGCAAATAGTGAAAAAAAGTTTTAGTTCACTACAACATTTAATCCATACATAGT[G/A]
AAACATTATAAGTACACTAGGTGAAGCATTTTTGGTGAAAAAAAATGGAACGAATTCCCTTAATAGAGGGTTTCCATAAGATGTGGGTGATTTCTTGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.30% 0.53% 0.00% NA
All Indica  2759 98.20% 1.70% 0.07% 0.00% NA
All Japonica  1512 5.50% 93.10% 1.46% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 7.40% 90.00% 2.61% 0.00% NA
Tropical Japonica  504 3.80% 95.80% 0.40% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114628121 C -> T LOC_Os11g25640.1 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1114628121 C -> T LOC_Os11g25640-LOC_Os11g25650 intergenic_region ; MODIFIER silent_mutation Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114628121 NA 4.86E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 1.89E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 4.62E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 3.87E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 6.07E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 7.43E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 6.33E-08 6.17E-08 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121 NA 2.56E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251