Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1114628121:

Variant ID: vg1114628121 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14628121
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCAAGAAATCACCCACATCTTATGGAAACCCTCTATTAAGGGAATTCGTTCCATTTTTTTTCACCAAAAATGCTTCACCTAGTGTACTTATAATGTTT[C/T]
ACTATGTATGGATTAAATGTTGTAGTGAACTAAAACTTTTTTTCACTATTTGCTAAAATATTTTTTTTATATAAGGTGAAACTGCGCCCGATTTAAACGA

Reverse complement sequence

TCGTTTAAATCGGGCGCAGTTTCACCTTATATAAAAAAAATATTTTAGCAAATAGTGAAAAAAAGTTTTAGTTCACTACAACATTTAATCCATACATAGT[G/A]
AAACATTATAAGTACACTAGGTGAAGCATTTTTGGTGAAAAAAAATGGAACGAATTCCCTTAATAGAGGGTTTCCATAAGATGTGGGTGATTTCTTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	33.30%	0.53%	0.00%	NA
All Indica	2759	98.20%	1.70%	0.07%	0.00%	NA
All Japonica	1512	5.50%	93.10%	1.46%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	95.80%	4.10%	0.13%	0.00%	NA
Temperate Japonica	767	7.40%	90.00%	2.61%	0.00%	NA
Tropical Japonica	504	3.80%	95.80%	0.40%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114628121	C -> T	LOC_Os11g25640.1	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1114628121	C -> T	LOC_Os11g25640-LOC_Os11g25650	intergenic_region ; MODIFIER	silent_mutation	Average:37.004; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114628121	NA	4.86E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	1.89E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	4.62E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	3.87E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	6.07E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	7.43E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	6.33E-08	6.17E-08	mr1648_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114628121	NA	2.56E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251