\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114601521:

Variant ID: vg1114601521 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14601521
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCGTTGCCGTCGGGGTCAGGCTCATTGTCGTCAGGGTCGGCGCCTCCTCGTCGTCGTCAGGGTCGGTGATGAGAACATCAACACCAACGATATATCCA[C/T]
GCCTCCACAAGTACAACTTCAACGTCCTATTACTCGCGCTCGTGCACGTCAACTCAACTATCAGGTGCATTCATTCTTAAATTCATATGATTCTTATTTA

Reverse complement sequence

TAAATAAGAATCATATGAATTTAAGAATGAATGCACCTGATAGTTGAGTTGACGTGCACGAGCGCGAGTAATAGGACGTTGAAGTTGTACTTGTGGAGGC[G/A]
TGGATATATCGTTGGTGTTGATGTTCTCATCACCGACCCTGACGACGACGAGGAGGCGCCGACCCTGACGACAATGAGCCTGACCCCGACGGCAACGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 25.30% 0.66% 37.77% NA
All Indica  2759 5.10% 32.00% 1.09% 61.76% NA
All Japonica  1512 96.20% 2.10% 0.00% 1.72% NA
Aus  269 0.00% 91.40% 0.00% 8.55% NA
Indica I  595 3.00% 38.00% 1.51% 57.48% NA
Indica II  465 2.60% 7.10% 2.15% 88.17% NA
Indica III  913 9.30% 42.90% 0.33% 47.43% NA
Indica Intermediate  786 3.40% 29.50% 1.02% 66.03% NA
Temperate Japonica  767 96.00% 2.70% 0.00% 1.30% NA
Tropical Japonica  504 96.00% 1.40% 0.00% 2.58% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 86.50% 9.40% 0.00% 4.17% NA
Intermediate  90 38.90% 28.90% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114601521 C -> T LOC_Os11g25610.1 upstream_gene_variant ; 4063.0bp to feature; MODIFIER silent_mutation Average:9.855; most accessible tissue: Callus, score: 48.487 N N N N
vg1114601521 C -> T LOC_Os11g25590.1 downstream_gene_variant ; 4244.0bp to feature; MODIFIER silent_mutation Average:9.855; most accessible tissue: Callus, score: 48.487 N N N N
vg1114601521 C -> T LOC_Os11g25600.1 downstream_gene_variant ; 2259.0bp to feature; MODIFIER silent_mutation Average:9.855; most accessible tissue: Callus, score: 48.487 N N N N
vg1114601521 C -> T LOC_Os11g25590-LOC_Os11g25600 intergenic_region ; MODIFIER silent_mutation Average:9.855; most accessible tissue: Callus, score: 48.487 N N N N
vg1114601521 C -> DEL N N silent_mutation Average:9.855; most accessible tissue: Callus, score: 48.487 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114601521 NA 8.29E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 2.03E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 1.44E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 2.18E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 3.29E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 4.17E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 4.22E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 NA 4.04E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521 4.68E-06 4.68E-06 mr1314_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251