\
| Variant ID: vg1114601521 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14601521 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 66. )
CGTCGTTGCCGTCGGGGTCAGGCTCATTGTCGTCAGGGTCGGCGCCTCCTCGTCGTCGTCAGGGTCGGTGATGAGAACATCAACACCAACGATATATCCA[C/T]
GCCTCCACAAGTACAACTTCAACGTCCTATTACTCGCGCTCGTGCACGTCAACTCAACTATCAGGTGCATTCATTCTTAAATTCATATGATTCTTATTTA
TAAATAAGAATCATATGAATTTAAGAATGAATGCACCTGATAGTTGAGTTGACGTGCACGAGCGCGAGTAATAGGACGTTGAAGTTGTACTTGTGGAGGC[G/A]
TGGATATATCGTTGGTGTTGATGTTCTCATCACCGACCCTGACGACGACGAGGAGGCGCCGACCCTGACGACAATGAGCCTGACCCCGACGGCAACGACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 25.30% | 0.66% | 37.77% | NA |
| All Indica | 2759 | 5.10% | 32.00% | 1.09% | 61.76% | NA |
| All Japonica | 1512 | 96.20% | 2.10% | 0.00% | 1.72% | NA |
| Aus | 269 | 0.00% | 91.40% | 0.00% | 8.55% | NA |
| Indica I | 595 | 3.00% | 38.00% | 1.51% | 57.48% | NA |
| Indica II | 465 | 2.60% | 7.10% | 2.15% | 88.17% | NA |
| Indica III | 913 | 9.30% | 42.90% | 0.33% | 47.43% | NA |
| Indica Intermediate | 786 | 3.40% | 29.50% | 1.02% | 66.03% | NA |
| Temperate Japonica | 767 | 96.00% | 2.70% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 96.00% | 1.40% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 86.50% | 9.40% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 38.90% | 28.90% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114601521 | C -> T | LOC_Os11g25610.1 | upstream_gene_variant ; 4063.0bp to feature; MODIFIER | silent_mutation | Average:9.855; most accessible tissue: Callus, score: 48.487 | N | N | N | N |
| vg1114601521 | C -> T | LOC_Os11g25590.1 | downstream_gene_variant ; 4244.0bp to feature; MODIFIER | silent_mutation | Average:9.855; most accessible tissue: Callus, score: 48.487 | N | N | N | N |
| vg1114601521 | C -> T | LOC_Os11g25600.1 | downstream_gene_variant ; 2259.0bp to feature; MODIFIER | silent_mutation | Average:9.855; most accessible tissue: Callus, score: 48.487 | N | N | N | N |
| vg1114601521 | C -> T | LOC_Os11g25590-LOC_Os11g25600 | intergenic_region ; MODIFIER | silent_mutation | Average:9.855; most accessible tissue: Callus, score: 48.487 | N | N | N | N |
| vg1114601521 | C -> DEL | N | N | silent_mutation | Average:9.855; most accessible tissue: Callus, score: 48.487 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114601521 | NA | 8.29E-23 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 2.03E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 1.44E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 2.18E-09 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 3.29E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 4.17E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 4.22E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | NA | 4.04E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114601521 | 4.68E-06 | 4.68E-06 | mr1314_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |