Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114601521:

Variant ID: vg1114601521 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14601521
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

CGTCGTTGCCGTCGGGGTCAGGCTCATTGTCGTCAGGGTCGGCGCCTCCTCGTCGTCGTCAGGGTCGGTGATGAGAACATCAACACCAACGATATATCCA[C/T]
GCCTCCACAAGTACAACTTCAACGTCCTATTACTCGCGCTCGTGCACGTCAACTCAACTATCAGGTGCATTCATTCTTAAATTCATATGATTCTTATTTA

Reverse complement sequence

TAAATAAGAATCATATGAATTTAAGAATGAATGCACCTGATAGTTGAGTTGACGTGCACGAGCGCGAGTAATAGGACGTTGAAGTTGTACTTGTGGAGGC[G/A]
TGGATATATCGTTGGTGTTGATGTTCTCATCACCGACCCTGACGACGACGAGGAGGCGCCGACCCTGACGACAATGAGCCTGACCCCGACGGCAACGACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	25.30%	0.66%	37.77%	NA
All Indica	2759	5.10%	32.00%	1.09%	61.76%	NA
All Japonica	1512	96.20%	2.10%	0.00%	1.72%	NA
Aus	269	0.00%	91.40%	0.00%	8.55%	NA
Indica I	595	3.00%	38.00%	1.51%	57.48%	NA
Indica II	465	2.60%	7.10%	2.15%	88.17%	NA
Indica III	913	9.30%	42.90%	0.33%	47.43%	NA
Indica Intermediate	786	3.40%	29.50%	1.02%	66.03%	NA
Temperate Japonica	767	96.00%	2.70%	0.00%	1.30%	NA
Tropical Japonica	504	96.00%	1.40%	0.00%	2.58%	NA
Japonica Intermediate	241	97.50%	1.20%	0.00%	1.24%	NA
VI/Aromatic	96	86.50%	9.40%	0.00%	4.17%	NA
Intermediate	90	38.90%	28.90%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114601521	C -> T	LOC_Os11g25610.1	upstream_gene_variant ; 4063.0bp to feature; MODIFIER	silent_mutation	Average:9.855; most accessible tissue: Callus, score: 48.487	N	N	N	N
vg1114601521	C -> T	LOC_Os11g25590.1	downstream_gene_variant ; 4244.0bp to feature; MODIFIER	silent_mutation	Average:9.855; most accessible tissue: Callus, score: 48.487	N	N	N	N
vg1114601521	C -> T	LOC_Os11g25600.1	downstream_gene_variant ; 2259.0bp to feature; MODIFIER	silent_mutation	Average:9.855; most accessible tissue: Callus, score: 48.487	N	N	N	N
vg1114601521	C -> T	LOC_Os11g25590-LOC_Os11g25600	intergenic_region ; MODIFIER	silent_mutation	Average:9.855; most accessible tissue: Callus, score: 48.487	N	N	N	N
vg1114601521	C -> DEL	N	N	silent_mutation	Average:9.855; most accessible tissue: Callus, score: 48.487	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114601521	NA	8.29E-23	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	2.03E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	1.44E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	2.18E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	3.29E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	4.17E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	4.22E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	NA	4.04E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114601521	4.68E-06	4.68E-06	mr1314_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251