\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114596184:

Variant ID: vg1114596184 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14596184
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATAGCTGAATTCGTAGCACTCTGTGACGTCTGTCAGCGAGTAAAGGCAGAACACCAAAGGCCAGCAGGTTTGCTACAGCCACTTCAGATTCCAGAAT[G/A]
GAAGTGGGAAGAAATCGGAATGGATTTCATCACCGGTTTGCCCAGGACATCATCGGGGCATGATTCTATTTGGGTAGTCGTTGACCGACTCACCAAAGTG

Reverse complement sequence

CACTTTGGTGAGTCGGTCAACGACTACCCAAATAGAATCATGCCCCGATGATGTCCTGGGCAAACCGGTGATGAAATCCATTCCGATTTCTTCCCACTTC[C/T]
ATTCTGGAATCTGAAGTGGCTGTAGCAAACCTGCTGGCCTTTGGTGTTCTGCCTTTACTCGCTGACAGACGTCACAGAGTGCTACGAATTCAGCTATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 2.80% 2.84% 1.42% NA
All Indica  2759 88.20% 4.90% 4.57% 2.36% NA
All Japonica  1512 99.70% 0.00% 0.20% 0.13% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 61.50% 15.10% 16.47% 6.89% NA
Indica II  465 92.00% 5.60% 1.94% 0.43% NA
Indica III  913 98.20% 0.20% 0.22% 1.31% NA
Indica Intermediate  786 94.50% 2.00% 2.16% 1.27% NA
Temperate Japonica  767 99.30% 0.00% 0.39% 0.26% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114596184 G -> A LOC_Os11g25590.1 stop_gained ; p.Trp970*; HIGH stop_gained Average:14.996; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N
vg1114596184 G -> DEL LOC_Os11g25590.1 N frameshift_variant Average:14.996; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114596184 3.29E-08 5.99E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 6.83E-08 6.78E-12 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 7.14E-09 5.16E-16 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 1.02E-07 1.25E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 1.74E-06 1.37E-20 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 NA 4.52E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 6.26E-06 3.22E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 1.70E-06 6.69E-10 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114596184 NA 2.48E-09 mr1745_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251