\
| Variant ID: vg1114473442 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14473442 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGCAGGTTCGTGTGGGTTCACGGCCTTGATTAATAATATTGTATAGCTTTGGAATCGTGTTTACAAAATAGCTTTGAGCAACTAAGAGTCTTTTAATGC[T/C]
GTTTACTGCAAACCCTAACCCTTTATATTATAACCCCCTTGTACTCCCTTGCATTTATCCTGCACTTGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTAC
GTACAACCACCGTACTCAACAAGACACACCCACAAGTGCAGGATAAATGCAAGGGAGTACAAGGGGGTTATAATATAAAGGGTTAGGGTTTGCAGTAAAC[A/G]
GCATTAAAAGACTCTTAGTTGCTCAAAGCTATTTTGTAAACACGATTCCAAAGCTATACAATATTATTAATCAAGGCCGTGAACCCACACGAACCTGCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 18.90% | 21.82% | 5.40% | NA |
| All Indica | 2759 | 25.40% | 31.10% | 35.01% | 8.52% | NA |
| All Japonica | 1512 | 97.40% | 0.60% | 1.65% | 0.40% | NA |
| Aus | 269 | 87.00% | 0.70% | 8.55% | 3.72% | NA |
| Indica I | 595 | 25.00% | 22.50% | 45.71% | 6.72% | NA |
| Indica II | 465 | 12.90% | 32.90% | 40.22% | 13.98% | NA |
| Indica III | 913 | 30.70% | 35.80% | 26.51% | 7.01% | NA |
| Indica Intermediate | 786 | 27.00% | 30.90% | 33.72% | 8.40% | NA |
| Temperate Japonica | 767 | 96.60% | 0.80% | 2.35% | 0.26% | NA |
| Tropical Japonica | 504 | 98.00% | 0.40% | 0.99% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 11.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 17.80% | 16.67% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114473442 | T -> DEL | N | N | silent_mutation | Average:10.87; most accessible tissue: Callus, score: 16.428 | N | N | N | N |
| vg1114473442 | T -> C | LOC_Os11g25380.1 | downstream_gene_variant ; 4527.0bp to feature; MODIFIER | silent_mutation | Average:10.87; most accessible tissue: Callus, score: 16.428 | N | N | N | N |
| vg1114473442 | T -> C | LOC_Os11g25390.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.87; most accessible tissue: Callus, score: 16.428 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114473442 | 1.57E-06 | NA | mr1089 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 6.09E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.76E-09 | NA | mr1109 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.54E-06 | 8.17E-12 | mr1109 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 5.28E-08 | 1.35E-36 | mr1129 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 3.08E-11 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 7.71E-07 | NA | mr1235 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 1.01E-07 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 6.30E-08 | NA | mr1243 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 2.52E-06 | 1.62E-07 | mr1243 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 8.58E-09 | 1.51E-31 | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.97E-06 | 4.26E-11 | mr1251 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 6.31E-07 | 3.16E-22 | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 3.55E-06 | 2.13E-08 | mr1253 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 2.55E-08 | 4.27E-29 | mr1255 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 9.23E-10 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 4.12E-10 | 1.87E-38 | mr1257 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 3.57E-07 | 2.32E-12 | mr1257 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 9.26E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.23E-08 | NA | mr1423 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 3.76E-07 | 4.91E-10 | mr1423 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 2.05E-07 | NA | mr1435 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 9.20E-10 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.02E-08 | NA | mr1599 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 9.99E-07 | 1.90E-09 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 2.62E-07 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.91E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 4.19E-11 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.27E-07 | 2.41E-38 | mr1129_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 5.63E-14 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 1.06E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 1.66E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 2.26E-08 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 3.61E-21 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 1.20E-08 | 2.48E-32 | mr1255_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 3.16E-06 | 5.95E-13 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | 2.94E-06 | 2.28E-37 | mr1257_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 2.16E-11 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 2.10E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114473442 | NA | 2.09E-08 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |