\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114456393:

Variant ID: vg1114456393 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14456393
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, G: 0.12, T: 0.01, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACCCCTTTAAATAAGCGCACTACCGACAGTGCGAATTCCAAGGAAAGGAGAGAGATGGCCGCCAGAAATTTCTGGGTCCGTTACGCGCAGCAGTTTT[G/C]
GGACTTCAATTTAAATTCACTCATGACCGTTGAACTTCGTACAATGTTATCGATAACTCTATGTCTCTACGGTTCTCATACCGAGATCGACCAGTTGAGA

Reverse complement sequence

TCTCAACTGGTCGATCTCGGTATGAGAACCGTAGAGACATAGAGTTATCGATAACATTGTACGAAGTTCAACGGTCATGAGTGAATTTAAATTGAAGTCC[C/G]
AAAACTGCTGCGCGTAACGGACCCAGAAATTTCTGGCGGCCATCTCTCTCCTTTCCTTGGAATTCGCACTGTCGGTAGTGCGCTTATTTAAAGGGGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 35.80% 7.30% 0.49% NA
All Indica  2759 83.70% 3.80% 11.67% 0.83% NA
All Japonica  1512 2.40% 96.60% 0.99% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 76.50% 7.10% 15.63% 0.84% NA
Indica II  465 87.70% 1.70% 9.89% 0.65% NA
Indica III  913 90.80% 0.90% 7.78% 0.55% NA
Indica Intermediate  786 78.50% 6.00% 14.25% 1.27% NA
Temperate Japonica  767 2.20% 96.50% 1.30% 0.00% NA
Tropical Japonica  504 2.80% 96.40% 0.79% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 9.40% 86.50% 4.17% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114456393 G -> DEL N N silent_mutation Average:12.148; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1114456393 G -> C LOC_Os11g25360.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:12.148; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1114456393 G -> C LOC_Os11g25350.1 downstream_gene_variant ; 4089.0bp to feature; MODIFIER silent_mutation Average:12.148; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1114456393 G -> C LOC_Os11g25360-LOC_Os11g25370 intergenic_region ; MODIFIER silent_mutation Average:12.148; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114456393 NA 1.80E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 5.14E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 8.10E-80 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 3.80E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 1.11E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 2.47E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 3.09E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 2.51E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 2.67E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 3.55E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 2.11E-26 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 3.55E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 4.98E-87 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 2.43E-85 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 1.14E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 1.54E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 9.08E-36 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 1.07E-20 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 6.64E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 3.30E-08 3.36E-108 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 4.21E-38 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 1.44E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 6.91E-15 2.27E-162 mr1758_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456393 NA 9.19E-09 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251