\
| Variant ID: vg1114456299 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14456299 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGCAAACTAGGGTTTTTTTGCGGGAGCGGAGAAGACGAGGGGCGCTTGAAGGCTAGAAAGTTTTGCGGCAAACGGACTTCAAAATGGATCCCCAAAACC[C/T]
CTTTAAATAAGCGCACTACCGACAGTGCGAATTCCAAGGAAAGGAGAGAGATGGCCGCCAGAAATTTCTGGGTCCGTTACGCGCAGCAGTTTTGGGACTT
AAGTCCCAAAACTGCTGCGCGTAACGGACCCAGAAATTTCTGGCGGCCATCTCTCTCCTTTCCTTGGAATTCGCACTGTCGGTAGTGCGCTTATTTAAAG[G/A]
GGTTTTGGGGATCCATTTTGAAGTCCGTTTGCCGCAAAACTTTCTAGCCTTCAAGCGCCCCTCGTCTTCTCCGCTCCCGCAAAAAAACCCTAGTTTGCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 6.80% | 4.23% | 3.11% | NA |
| All Indica | 2759 | 89.60% | 0.10% | 5.15% | 5.07% | NA |
| All Japonica | 1512 | 76.10% | 20.40% | 3.44% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.40% | 0.00% | 5.71% | 2.86% | NA |
| Indica II | 465 | 75.70% | 0.00% | 10.75% | 13.55% | NA |
| Indica III | 913 | 95.60% | 0.10% | 1.53% | 2.74% | NA |
| Indica Intermediate | 786 | 89.60% | 0.40% | 5.60% | 4.45% | NA |
| Temperate Japonica | 767 | 95.60% | 1.30% | 3.00% | 0.13% | NA |
| Tropical Japonica | 504 | 40.90% | 55.40% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 7.90% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 8.90% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114456299 | C -> T | LOC_Os11g25360.1 | upstream_gene_variant ; 216.0bp to feature; MODIFIER | silent_mutation | Average:15.127; most accessible tissue: Callus, score: 31.107 | N | N | N | N |
| vg1114456299 | C -> T | LOC_Os11g25350.1 | downstream_gene_variant ; 3995.0bp to feature; MODIFIER | silent_mutation | Average:15.127; most accessible tissue: Callus, score: 31.107 | N | N | N | N |
| vg1114456299 | C -> T | LOC_Os11g25360-LOC_Os11g25370 | intergenic_region ; MODIFIER | silent_mutation | Average:15.127; most accessible tissue: Callus, score: 31.107 | N | N | N | N |
| vg1114456299 | C -> DEL | N | N | silent_mutation | Average:15.127; most accessible tissue: Callus, score: 31.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114456299 | NA | 2.42E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 5.82E-11 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 2.22E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 1.84E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 2.21E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 2.64E-08 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 6.20E-06 | NA | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 2.67E-06 | NA | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 5.30E-06 | NA | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 5.05E-07 | 6.61E-09 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 1.89E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.04E-06 | NA | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 6.65E-07 | 2.50E-10 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 1.11E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 8.15E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 7.40E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 4.88E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 7.31E-08 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 2.18E-08 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 9.25E-10 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.24E-06 | 2.82E-09 | mr1642 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 4.19E-07 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 5.62E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 5.56E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.64E-06 | 3.63E-06 | mr1815 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 5.01E-14 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 5.26E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 5.97E-06 | mr1892 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 7.26E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.30E-06 | NA | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.92E-07 | NA | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | 3.16E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 1.49E-07 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 4.79E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 6.89E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 3.20E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114456299 | NA | 3.73E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |