\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114456299:

Variant ID: vg1114456299 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14456299
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCAAACTAGGGTTTTTTTGCGGGAGCGGAGAAGACGAGGGGCGCTTGAAGGCTAGAAAGTTTTGCGGCAAACGGACTTCAAAATGGATCCCCAAAACC[C/T]
CTTTAAATAAGCGCACTACCGACAGTGCGAATTCCAAGGAAAGGAGAGAGATGGCCGCCAGAAATTTCTGGGTCCGTTACGCGCAGCAGTTTTGGGACTT

Reverse complement sequence

AAGTCCCAAAACTGCTGCGCGTAACGGACCCAGAAATTTCTGGCGGCCATCTCTCTCCTTTCCTTGGAATTCGCACTGTCGGTAGTGCGCTTATTTAAAG[G/A]
GGTTTTGGGGATCCATTTTGAAGTCCGTTTGCCGCAAAACTTTCTAGCCTTCAAGCGCCCCTCGTCTTCTCCGCTCCCGCAAAAAAACCCTAGTTTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 6.80% 4.23% 3.11% NA
All Indica  2759 89.60% 0.10% 5.15% 5.07% NA
All Japonica  1512 76.10% 20.40% 3.44% 0.07% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 91.40% 0.00% 5.71% 2.86% NA
Indica II  465 75.70% 0.00% 10.75% 13.55% NA
Indica III  913 95.60% 0.10% 1.53% 2.74% NA
Indica Intermediate  786 89.60% 0.40% 5.60% 4.45% NA
Temperate Japonica  767 95.60% 1.30% 3.00% 0.13% NA
Tropical Japonica  504 40.90% 55.40% 3.77% 0.00% NA
Japonica Intermediate  241 88.00% 7.90% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 8.90% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114456299 C -> T LOC_Os11g25360.1 upstream_gene_variant ; 216.0bp to feature; MODIFIER silent_mutation Average:15.127; most accessible tissue: Callus, score: 31.107 N N N N
vg1114456299 C -> T LOC_Os11g25350.1 downstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:15.127; most accessible tissue: Callus, score: 31.107 N N N N
vg1114456299 C -> T LOC_Os11g25360-LOC_Os11g25370 intergenic_region ; MODIFIER silent_mutation Average:15.127; most accessible tissue: Callus, score: 31.107 N N N N
vg1114456299 C -> DEL N N silent_mutation Average:15.127; most accessible tissue: Callus, score: 31.107 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114456299 NA 2.42E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 5.82E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 2.22E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 1.84E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 2.21E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 2.64E-08 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 6.20E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 2.67E-06 NA mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 5.30E-06 NA mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 5.05E-07 6.61E-09 mr1448 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 1.89E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.04E-06 NA mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 6.65E-07 2.50E-10 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 1.11E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 8.15E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 7.40E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 4.88E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 7.31E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 2.18E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 9.25E-10 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.24E-06 2.82E-09 mr1642 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 4.19E-07 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 5.62E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 5.56E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.64E-06 3.63E-06 mr1815 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 5.01E-14 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 5.26E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 5.97E-06 mr1892 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 7.26E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.30E-06 NA mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.92E-07 NA mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 3.16E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 1.49E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 4.79E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 6.89E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 3.20E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114456299 NA 3.73E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251