\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114404010:

Variant ID: vg1114404010 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14404010
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTTCCTCCACGACAATGCAGACGTGTTCGCTTGGCAGCCGTCCAACATGCCCGGGGTCCCCAGGGAGGTGATTGAGCACAAACTCATGGTGCGACCC[A/G,T]
ATGCCAAGCCAATAAAACAAAAATGCGGAGATTTGCACCAGACCGGAAACAACCCATACGAGAAGAGCTCGACAAGCTTCTCAAAGCTGGCTTCATCAGA

Reverse complement sequence

TCTGATGAAGCCAGCTTTGAGAAGCTTGTCGAGCTCTTCTCGTATGGGTTGTTTCCGGTCTGGTGCAAATCTCCGCATTTTTGTTTTATTGGCTTGGCAT[T/C,A]
GGGTCGCACCATGAGTTTGTGCTCAATCACCTCCCTGGGGACCCCGGGCATGTTGGACGGCTGCCAAGCGAACACGTCTGCATTGTCGTGGAGGAAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 29.60% 1.21% 6.45% T: 0.06%
All Indica  2759 93.10% 1.60% 1.70% 3.48% T: 0.11%
All Japonica  1512 3.70% 83.10% 0.53% 12.63% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.80% 2.90% 1.34% 3.03% NA
Indica II  465 94.60% 0.40% 1.94% 3.01% NA
Indica III  913 93.60% 0.50% 1.64% 3.83% T: 0.33%
Indica Intermediate  786 91.90% 2.50% 1.91% 3.69% NA
Temperate Japonica  767 4.00% 80.80% 0.78% 14.34% NA
Tropical Japonica  504 3.60% 90.30% 0.20% 5.95% NA
Japonica Intermediate  241 2.90% 75.50% 0.41% 21.16% NA
VI/Aromatic  96 15.60% 66.70% 1.04% 16.67% NA
Intermediate  90 60.00% 36.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114404010 A -> T LOC_Os11g25280.1 upstream_gene_variant ; 240.0bp to feature; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> T LOC_Os11g25270.1 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> T LOC_Os11g25270-LOC_Os11g25280 intergenic_region ; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> DEL N N silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> G LOC_Os11g25280.1 upstream_gene_variant ; 240.0bp to feature; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> G LOC_Os11g25270.1 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1114404010 A -> G LOC_Os11g25270-LOC_Os11g25280 intergenic_region ; MODIFIER silent_mutation Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114404010 NA 8.91E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 3.72E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 1.04E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 1.00E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 4.15E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 1.19E-06 NA mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 7.09E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 1.37E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 2.85E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 2.41E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 5.73E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 3.90E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 4.92E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010 NA 2.90E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251