\
| Variant ID: vg1114404010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14404010 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
CACCTTCCTCCACGACAATGCAGACGTGTTCGCTTGGCAGCCGTCCAACATGCCCGGGGTCCCCAGGGAGGTGATTGAGCACAAACTCATGGTGCGACCC[A/G,T]
ATGCCAAGCCAATAAAACAAAAATGCGGAGATTTGCACCAGACCGGAAACAACCCATACGAGAAGAGCTCGACAAGCTTCTCAAAGCTGGCTTCATCAGA
TCTGATGAAGCCAGCTTTGAGAAGCTTGTCGAGCTCTTCTCGTATGGGTTGTTTCCGGTCTGGTGCAAATCTCCGCATTTTTGTTTTATTGGCTTGGCAT[T/C,A]
GGGTCGCACCATGAGTTTGTGCTCAATCACCTCCCTGGGGACCCCGGGCATGTTGGACGGCTGCCAAGCGAACACGTCTGCATTGTCGTGGAGGAAGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 29.60% | 1.21% | 6.45% | T: 0.06% |
| All Indica | 2759 | 93.10% | 1.60% | 1.70% | 3.48% | T: 0.11% |
| All Japonica | 1512 | 3.70% | 83.10% | 0.53% | 12.63% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 2.90% | 1.34% | 3.03% | NA |
| Indica II | 465 | 94.60% | 0.40% | 1.94% | 3.01% | NA |
| Indica III | 913 | 93.60% | 0.50% | 1.64% | 3.83% | T: 0.33% |
| Indica Intermediate | 786 | 91.90% | 2.50% | 1.91% | 3.69% | NA |
| Temperate Japonica | 767 | 4.00% | 80.80% | 0.78% | 14.34% | NA |
| Tropical Japonica | 504 | 3.60% | 90.30% | 0.20% | 5.95% | NA |
| Japonica Intermediate | 241 | 2.90% | 75.50% | 0.41% | 21.16% | NA |
| VI/Aromatic | 96 | 15.60% | 66.70% | 1.04% | 16.67% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114404010 | A -> T | LOC_Os11g25280.1 | upstream_gene_variant ; 240.0bp to feature; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> T | LOC_Os11g25270.1 | downstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> T | LOC_Os11g25270-LOC_Os11g25280 | intergenic_region ; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> DEL | N | N | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> G | LOC_Os11g25280.1 | upstream_gene_variant ; 240.0bp to feature; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> G | LOC_Os11g25270.1 | downstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1114404010 | A -> G | LOC_Os11g25270-LOC_Os11g25280 | intergenic_region ; MODIFIER | silent_mutation | Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114404010 | NA | 8.91E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 3.72E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 1.04E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 1.00E-10 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 4.15E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | 1.19E-06 | NA | mr1742 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 7.09E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 1.37E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 2.85E-20 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 2.41E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 5.73E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 3.90E-18 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 4.92E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114404010 | NA | 2.90E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |