\
| Variant ID: vg1114401699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14401699 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )
CACGAGCTGTCGGTTCTACACTTGCTCGAAGACCAGGCCTCATCATCGACGAGTACACCACGTGATGTGTTCGTTATCGATAGGACCAGCATGTCTGCGC[A/G]
CGCTAACGCATAAGCGGAGGATCAAGTGGTTACACTGGCCCAGCACATCAGGGCCATCAACGCAATACTGAGGGAAACCCCTTATGATCCCGTTCTGAAC
GTTCAGAACGGGATCATAAGGGGTTTCCCTCAGTATTGCGTTGATGGCCCTGATGTGCTGGGCCAGTGTAACCACTTGATCCTCCGCTTATGCGTTAGCG[T/C]
GCGCAGACATGCTGGTCCTATCGATAACGAACACATCACGTGGTGTACTCGTCGATGATGAGGCCTGGTCTTCGAGCAAGTGTAGAACCGACAGCTCGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 29.20% | 1.35% | 3.53% | NA |
| All Indica | 2759 | 98.50% | 1.30% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 3.90% | 82.70% | 3.04% | 10.38% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.30% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 4.20% | 80.30% | 1.56% | 13.95% | NA |
| Tropical Japonica | 504 | 3.80% | 89.90% | 3.17% | 3.17% | NA |
| Japonica Intermediate | 241 | 3.30% | 75.10% | 7.47% | 14.11% | NA |
| VI/Aromatic | 96 | 16.70% | 64.60% | 10.42% | 8.33% | NA |
| Intermediate | 90 | 61.10% | 34.40% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114401699 | A -> DEL | N | N | silent_mutation | Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg1114401699 | A -> G | LOC_Os11g25260.1 | upstream_gene_variant ; 3576.0bp to feature; MODIFIER | silent_mutation | Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg1114401699 | A -> G | LOC_Os11g25270.1 | upstream_gene_variant ; 436.0bp to feature; MODIFIER | silent_mutation | Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg1114401699 | A -> G | LOC_Os11g25280.1 | upstream_gene_variant ; 2551.0bp to feature; MODIFIER | silent_mutation | Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg1114401699 | A -> G | LOC_Os11g25260-LOC_Os11g25270 | intergenic_region ; MODIFIER | silent_mutation | Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114401699 | NA | 4.30E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.30E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 5.05E-21 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 3.31E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.36E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.91E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | 8.33E-07 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 4.47E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.36E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.32E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 1.31E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 2.09E-18 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 1.97E-23 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114401699 | NA | 5.94E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |