\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114401699:

Variant ID: vg1114401699 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14401699
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CACGAGCTGTCGGTTCTACACTTGCTCGAAGACCAGGCCTCATCATCGACGAGTACACCACGTGATGTGTTCGTTATCGATAGGACCAGCATGTCTGCGC[A/G]
CGCTAACGCATAAGCGGAGGATCAAGTGGTTACACTGGCCCAGCACATCAGGGCCATCAACGCAATACTGAGGGAAACCCCTTATGATCCCGTTCTGAAC

Reverse complement sequence

GTTCAGAACGGGATCATAAGGGGTTTCCCTCAGTATTGCGTTGATGGCCCTGATGTGCTGGGCCAGTGTAACCACTTGATCCTCCGCTTATGCGTTAGCG[T/C]
GCGCAGACATGCTGGTCCTATCGATAACGAACACATCACGTGGTGTACTCGTCGATGATGAGGCCTGGTCTTCGAGCAAGTGTAGAACCGACAGCTCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 29.20% 1.35% 3.53% NA
All Indica  2759 98.50% 1.30% 0.18% 0.04% NA
All Japonica  1512 3.90% 82.70% 3.04% 10.38% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.50% 0.33% 0.00% NA
Indica Intermediate  786 97.30% 2.30% 0.25% 0.13% NA
Temperate Japonica  767 4.20% 80.30% 1.56% 13.95% NA
Tropical Japonica  504 3.80% 89.90% 3.17% 3.17% NA
Japonica Intermediate  241 3.30% 75.10% 7.47% 14.11% NA
VI/Aromatic  96 16.70% 64.60% 10.42% 8.33% NA
Intermediate  90 61.10% 34.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114401699 A -> DEL N N silent_mutation Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1114401699 A -> G LOC_Os11g25260.1 upstream_gene_variant ; 3576.0bp to feature; MODIFIER silent_mutation Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1114401699 A -> G LOC_Os11g25270.1 upstream_gene_variant ; 436.0bp to feature; MODIFIER silent_mutation Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1114401699 A -> G LOC_Os11g25280.1 upstream_gene_variant ; 2551.0bp to feature; MODIFIER silent_mutation Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1114401699 A -> G LOC_Os11g25260-LOC_Os11g25270 intergenic_region ; MODIFIER silent_mutation Average:49.731; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114401699 NA 4.30E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.30E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 5.05E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 3.31E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.36E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.91E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 8.33E-07 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 4.47E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.36E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.32E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 1.31E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 2.09E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 1.97E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401699 NA 5.94E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251