\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114401405:

Variant ID: vg1114401405 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14401405
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAAACCAGGAAACACACCTTGTAGGCTTGCTGGGTTTTTCTCGACGTACAAGCTGAGATCTGTGCCTGCAAAGAGCGTGGAATTCAATGTACTTCTC[T/C]
AACCCGTGATGTCTATTGTCATATTCACAAGACAAAGAATCACGACCTCTCAAGCTGCAAGGTTCTTCTCAGTGCCATGAGGACGTCACCTCCTAAGGTC

Reverse complement sequence

GACCTTAGGAGGTGACGTCCTCATGGCACTGAGAAGAACCTTGCAGCTTGAGAGGTCGTGATTCTTTGTCTTGTGAATATGACAATAGACATCACGGGTT[A/G]
GAGAAGTACATTGAATTCCACGCTCTTTGCAGGCACAGATCTCAGCTTGTACGTCGAGAAAAACCCAGCAAGCCTACAAGGTGTGTTTCCTGGTTTTGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 29.20% 0.53% 4.21% NA
All Indica  2759 98.60% 1.30% 0.00% 0.04% NA
All Japonica  1512 4.00% 82.70% 1.39% 11.90% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.00% 0.13% NA
Temperate Japonica  767 4.40% 80.30% 1.96% 13.30% NA
Tropical Japonica  504 3.80% 89.90% 0.20% 6.15% NA
Japonica Intermediate  241 3.30% 75.10% 2.07% 19.50% NA
VI/Aromatic  96 16.70% 64.60% 2.08% 16.67% NA
Intermediate  90 62.20% 33.30% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114401405 T -> DEL N N silent_mutation Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1114401405 T -> C LOC_Os11g25260.1 upstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1114401405 T -> C LOC_Os11g25270.1 upstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1114401405 T -> C LOC_Os11g25280.1 upstream_gene_variant ; 2845.0bp to feature; MODIFIER silent_mutation Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1114401405 T -> C LOC_Os11g25260-LOC_Os11g25270 intergenic_region ; MODIFIER silent_mutation Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114401405 9.50E-06 NA mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 7.45E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 1.69E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 8.01E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 4.22E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 8.72E-07 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 5.67E-23 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 8.48E-07 2.40E-07 mr1782 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 6.26E-07 6.26E-07 mr1782 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 1.23E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 3.26E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 3.06E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 2.04E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 5.28E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405 NA 2.27E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251