Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114401405:

Variant ID: vg1114401405 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14401405
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CACAAAACCAGGAAACACACCTTGTAGGCTTGCTGGGTTTTTCTCGACGTACAAGCTGAGATCTGTGCCTGCAAAGAGCGTGGAATTCAATGTACTTCTC[T/C]
AACCCGTGATGTCTATTGTCATATTCACAAGACAAAGAATCACGACCTCTCAAGCTGCAAGGTTCTTCTCAGTGCCATGAGGACGTCACCTCCTAAGGTC

Reverse complement sequence

GACCTTAGGAGGTGACGTCCTCATGGCACTGAGAAGAACCTTGCAGCTTGAGAGGTCGTGATTCTTTGTCTTGTGAATATGACAATAGACATCACGGGTT[A/G]
GAGAAGTACATTGAATTCCACGCTCTTTGCAGGCACAGATCTCAGCTTGTACGTCGAGAAAAACCCAGCAAGCCTACAAGGTGTGTTTCCTGGTTTTGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	29.20%	0.53%	4.21%	NA
All Indica	2759	98.60%	1.30%	0.00%	0.04%	NA
All Japonica	1512	4.00%	82.70%	1.39%	11.90%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.00%	0.13%	NA
Temperate Japonica	767	4.40%	80.30%	1.96%	13.30%	NA
Tropical Japonica	504	3.80%	89.90%	0.20%	6.15%	NA
Japonica Intermediate	241	3.30%	75.10%	2.07%	19.50%	NA
VI/Aromatic	96	16.70%	64.60%	2.08%	16.67%	NA
Intermediate	90	62.20%	33.30%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114401405	T -> DEL	N	N	silent_mutation	Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg1114401405	T -> C	LOC_Os11g25260.1	upstream_gene_variant ; 3282.0bp to feature; MODIFIER	silent_mutation	Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg1114401405	T -> C	LOC_Os11g25270.1	upstream_gene_variant ; 730.0bp to feature; MODIFIER	silent_mutation	Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg1114401405	T -> C	LOC_Os11g25280.1	upstream_gene_variant ; 2845.0bp to feature; MODIFIER	silent_mutation	Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg1114401405	T -> C	LOC_Os11g25260-LOC_Os11g25270	intergenic_region ; MODIFIER	silent_mutation	Average:39.055; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114401405	9.50E-06	NA	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	7.45E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	1.69E-20	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	8.01E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	4.22E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	8.72E-07	NA	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	5.67E-23	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	8.48E-07	2.40E-07	mr1782	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	6.26E-07	6.26E-07	mr1782	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	1.23E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	3.26E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	3.06E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	2.04E-23	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	5.28E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401405	NA	2.27E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251