\
| Variant ID: vg1114265238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14265238 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACTAAAAGTCCATTAAACTTCCTACAAACGCTCCTAAACCGCCATGTGGCGCTCCTATAAACGCTCCTAGATTGCCATGTGGCGCTTTAATAAATCCTA[T/G]
AAATTATAAGAAAAAAGCAAAACATCTAGCCATCGATTTTCATTTAATCTGGTGGACCCACTATTTTAAACCATTAGATTTTGTTAAGAAAAAACCCAAA
TTTGGGTTTTTTCTTAACAAAATCTAATGGTTTAAAATAGTGGGTCCACCAGATTAAATGAAAATCGATGGCTAGATGTTTTGCTTTTTTCTTATAATTT[A/C]
TAGGATTTATTAAAGCGCCACATGGCAATCTAGGAGCGTTTATAGGAGCGCCACATGGCGGTTTAGGAGCGTTTGTAGGAAGTTTAATGGACTTTTAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 9.40% | 3.55% | 0.68% | NA |
| All Indica | 2759 | 98.60% | 0.20% | 0.98% | 0.29% | NA |
| All Japonica | 1512 | 63.00% | 28.40% | 8.66% | 0.00% | NA |
| Aus | 269 | 91.40% | 0.00% | 0.00% | 8.55% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 96.20% | 0.30% | 2.80% | 0.76% | NA |
| Temperate Japonica | 767 | 39.60% | 49.50% | 10.82% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 2.40% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 15.40% | 9.13% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 2.10% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114265238 | T -> DEL | N | N | silent_mutation | Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg1114265238 | T -> G | LOC_Os11g25040.1 | upstream_gene_variant ; 2499.0bp to feature; MODIFIER | silent_mutation | Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg1114265238 | T -> G | LOC_Os11g25050.1 | downstream_gene_variant ; 4803.0bp to feature; MODIFIER | silent_mutation | Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg1114265238 | T -> G | LOC_Os11g25020-LOC_Os11g25040 | intergenic_region ; MODIFIER | silent_mutation | Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114265238 | NA | 1.74E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | NA | 1.39E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | NA | 6.38E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | 6.46E-07 | NA | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | NA | 6.30E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | NA | 6.93E-10 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114265238 | NA | 6.89E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |