\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114265238:

Variant ID: vg1114265238 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14265238
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTAAAAGTCCATTAAACTTCCTACAAACGCTCCTAAACCGCCATGTGGCGCTCCTATAAACGCTCCTAGATTGCCATGTGGCGCTTTAATAAATCCTA[T/G]
AAATTATAAGAAAAAAGCAAAACATCTAGCCATCGATTTTCATTTAATCTGGTGGACCCACTATTTTAAACCATTAGATTTTGTTAAGAAAAAACCCAAA

Reverse complement sequence

TTTGGGTTTTTTCTTAACAAAATCTAATGGTTTAAAATAGTGGGTCCACCAGATTAAATGAAAATCGATGGCTAGATGTTTTGCTTTTTTCTTATAATTT[A/C]
TAGGATTTATTAAAGCGCCACATGGCAATCTAGGAGCGTTTATAGGAGCGCCACATGGCGGTTTAGGAGCGTTTGTAGGAAGTTTAATGGACTTTTAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 9.40% 3.55% 0.68% NA
All Indica  2759 98.60% 0.20% 0.98% 0.29% NA
All Japonica  1512 63.00% 28.40% 8.66% 0.00% NA
Aus  269 91.40% 0.00% 0.00% 8.55% NA
Indica I  595 99.20% 0.20% 0.67% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.70% 0.10% 0.00% 0.22% NA
Indica Intermediate  786 96.20% 0.30% 2.80% 0.76% NA
Temperate Japonica  767 39.60% 49.50% 10.82% 0.00% NA
Tropical Japonica  504 92.50% 2.40% 5.16% 0.00% NA
Japonica Intermediate  241 75.50% 15.40% 9.13% 0.00% NA
VI/Aromatic  96 92.70% 2.10% 5.21% 0.00% NA
Intermediate  90 86.70% 6.70% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114265238 T -> DEL N N silent_mutation Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1114265238 T -> G LOC_Os11g25040.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1114265238 T -> G LOC_Os11g25050.1 downstream_gene_variant ; 4803.0bp to feature; MODIFIER silent_mutation Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1114265238 T -> G LOC_Os11g25020-LOC_Os11g25040 intergenic_region ; MODIFIER silent_mutation Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114265238 NA 1.74E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 NA 1.39E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 NA 6.38E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 6.46E-07 NA mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 NA 6.30E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 NA 6.93E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238 NA 6.89E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251