\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114063604:

Variant ID: vg1114063604 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14063604
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGAAATAATCAATAATTTTAAATCACATAAAACCAGATGAGAGATATGTAAATTTTGTGAACAATGTTACTATCACTTTGTCGGATGAAGAAATAAC[T/C]
AAAATAAAAGTTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGACTTTTTTAAGTTAAAATCATTTATTATTTGAAAATGATGTTTGAAGTTGT

Reverse complement sequence

ACAACTTCAAACATCATTTTCAAATAATAAATGATTTTAACTTAAAAAAGTCATCAACAACAAAGTTGTATAACTCATCAAGATCTATAACTTTTATTTT[A/G]
GTTATTTCTTCATCCGACAAAGTGATAGTAACATTGTTCACAAAATTTACATATCTCTCATCTGGTTTTATGTGATTTAAAATTATTGATTATTTCTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.30% 34.60% 0.17% 18.92% NA
All Indica  2759 69.80% 2.00% 0.25% 28.02% NA
All Japonica  1512 2.00% 96.50% 0.00% 1.52% NA
Aus  269 72.10% 1.10% 0.00% 26.77% NA
Indica I  595 92.30% 2.00% 0.00% 5.71% NA
Indica II  465 41.10% 1.50% 0.22% 57.20% NA
Indica III  913 75.70% 0.80% 0.11% 23.44% NA
Indica Intermediate  786 62.80% 3.60% 0.64% 32.95% NA
Temperate Japonica  767 1.70% 96.20% 0.00% 2.09% NA
Tropical Japonica  504 2.40% 96.40% 0.00% 1.19% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 86.50% 0.00% 3.12% NA
Intermediate  90 34.40% 38.90% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114063604 T -> DEL N N silent_mutation Average:17.481; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1114063604 T -> C LOC_Os11g24650.1 downstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:17.481; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1114063604 T -> C LOC_Os11g24660.1 downstream_gene_variant ; 3380.0bp to feature; MODIFIER silent_mutation Average:17.481; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1114063604 T -> C LOC_Os11g24650-LOC_Os11g24660 intergenic_region ; MODIFIER silent_mutation Average:17.481; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114063604 NA 5.53E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 2.42E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 3.13E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 1.70E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 1.07E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 8.88E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 2.03E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 6.29E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 7.37E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 2.96E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 1.48E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 NA 6.07E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 4.88E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114063604 4.71E-06 NA mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251