Variant ID: vg1113972556 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 13972556 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )
TACCTTTACCGTAGCGAAGGTCAAGTCATTTGCATATGTGATTGTGAATCTGCAAATCAATAATACTTTAAAATGAAAGTGTAATTGTGGAAAAAAGTTT[G/T]
CATACTCAGATAATTATTTCCTATGCCTTTTGTTACAGTAACAAACTATATATCTGCAAGTTATAAATTCTCACCCTGCAGACTGCCCATCGATATGCCA
TGGCATATCGATGGGCAGTCTGCAGGGTGAGAATTTATAACTTGCAGATATATAGTTTGTTACTGTAACAAAAGGCATAGGAAATAATTATCTGAGTATG[C/A]
AAACTTTTTTCCACAATTACACTTTCATTTTAAAGTATTATTGATTTGCAGATTCACAATCACATATGCAAATGACTTGACCTTCGCTACGGTAAAGGTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.90% | 4.80% | 0.30% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 84.90% | 14.20% | 0.93% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 56.70% | 41.30% | 1.98% | 0.00% | NA |
Japonica Intermediate | 241 | 97.10% | 1.70% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1113972556 | G -> T | LOC_Os11g24500.1 | upstream_gene_variant ; 1472.0bp to feature; MODIFIER | silent_mutation | Average:59.026; most accessible tissue: Callus, score: 75.996 | N | N | N | N |
vg1113972556 | G -> T | LOC_Os11g24510.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.026; most accessible tissue: Callus, score: 75.996 | N | N | N | N |
vg1113972556 | G -> T | LOC_Os11g24510.2 | intron_variant ; MODIFIER | silent_mutation | Average:59.026; most accessible tissue: Callus, score: 75.996 | N | N | N | N |
vg1113972556 | G -> T | LOC_Os11g24510.3 | intron_variant ; MODIFIER | silent_mutation | Average:59.026; most accessible tissue: Callus, score: 75.996 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1113972556 | NA | 1.66E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 3.86E-12 | mr1248 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 5.04E-07 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 7.49E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 9.55E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 3.28E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 2.51E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1113972556 | NA | 2.04E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |