Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1113912544:

Variant ID: vg1113912544 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13912544
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATATACCTCGTTAGATTTGTCTCACAAAATAGCCTAGGGGTTATGGAATGGGTTTTATCAGTAATCTACGTTTAATACTCCTAAATAGCAAGATTCCGAA[A/G]
GGCTATTTAATAGCTCTCCGGATCCAAACAGGGCCTATGTATGTTTATAACAGCAGGTGCATATTTTGCTCCAAAGGGGCAAAAGTGTTAGTCCTACATA

Reverse complement sequence

TATGTAGGACTAACACTTTTGCCCCTTTGGAGCAAAATATGCACCTGCTGTTATAAACATACATAGGCCCTGTTTGGATCCGGAGAGCTATTAAATAGCC[T/C]
TTCGGAATCTTGCTATTTAGGAGTATTAAACGTAGATTACTGATAAAACCCATTCCATAACCCCTAGGCTATTTTGTGAGACAAATCTAACGAGGTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 34.30% 0.47% 8.21% NA
All Indica  2759 84.60% 1.50% 0.62% 13.27% NA
All Japonica  1512 2.90% 96.30% 0.13% 0.66% NA
Aus  269 97.40% 1.90% 0.74% 0.00% NA
Indica I  595 75.10% 2.40% 0.84% 21.68% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 80.10% 0.50% 0.99% 18.40% NA
Indica Intermediate  786 88.50% 2.50% 0.38% 8.52% NA
Temperate Japonica  767 3.40% 95.80% 0.26% 0.52% NA
Tropical Japonica  504 2.80% 96.40% 0.00% 0.79% NA
Japonica Intermediate  241 1.70% 97.50% 0.00% 0.83% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 48.90% 36.70% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113912544 A -> DEL N N silent_mutation Average:57.936; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg1113912544 A -> G LOC_Os11g24420.1 upstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:57.936; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg1113912544 A -> G LOC_Os11g24374.1 intron_variant ; MODIFIER silent_mutation Average:57.936; most accessible tissue: Minghui63 root, score: 80.76 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113912544 NA 6.70E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.86E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.65E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.52E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.50E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 6.84E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.43E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.75E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 8.18E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 4.71E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 2.14E-06 5.64E-17 mr1361 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.10E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.33E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 8.87E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 4.35E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 9.75E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.24E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 7.20E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.33E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 7.76E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.20E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.26E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.96E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.75E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.62E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.50E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.67E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.66E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 6.79E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 9.38E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.41E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.90E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.03E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.69E-17 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.70E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.89E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.18E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.09E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.02E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.96E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 5.69E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 8.93E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 3.59E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 2.13E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113912544 NA 1.37E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251