\
| Variant ID: vg1113530105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13530105 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTTTACTCATTAATTGCTCAATAAAATTAGCTTTATGCAAATGTTGAACCTAGAGACCCACTATAGGCTAGAAAGCTTGCATACTTCTCTCTCCCTTAT[A/G]
TATATATAATTTTGGGTAAGACTTGCGAGTACAATCTTGTACTTAAACCGGTGTCTGCAATTTCAGGAGAGGATTCCGGTTATGAGTTATGTTTCTTGTG
CACAAGAAACATAACTCATAACCGGAATCCTCTCCTGAAATTGCAGACACCGGTTTAAGTACAAGATTGTACTCGCAAGTCTTACCCAAAATTATATATA[T/C]
ATAAGGGAGAGAGAAGTATGCAAGCTTTCTAGCCTATAGTGGGTCTCTAGGTTCAACATTTGCATAAAGCTAATTTTATTGAGCAATTAATGAGTAAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 0.30% | 0.89% | 1.78% | NA |
| All Indica | 2759 | 95.20% | 0.50% | 1.38% | 2.97% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.13% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 0.50% | 0.84% | 3.53% | NA |
| Indica II | 465 | 96.80% | 0.60% | 1.72% | 0.86% | NA |
| Indica III | 913 | 94.40% | 0.40% | 0.77% | 4.38% | NA |
| Indica Intermediate | 786 | 95.20% | 0.40% | 2.29% | 2.16% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113530105 | A -> DEL | N | N | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23880.1 | downstream_gene_variant ; 3848.0bp to feature; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23890.1 | downstream_gene_variant ; 2298.0bp to feature; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23880.4 | downstream_gene_variant ; 3840.0bp to feature; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23880.2 | downstream_gene_variant ; 3848.0bp to feature; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23880.3 | downstream_gene_variant ; 3848.0bp to feature; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg1113530105 | A -> G | LOC_Os11g23880-LOC_Os11g23890 | intergenic_region ; MODIFIER | silent_mutation | Average:22.497; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113530105 | 4.43E-06 | NA | mr1619 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |