\
| Variant ID: vg1113429006 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13429006 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )
CAAGCAGAAGCAGTAGGATGGAAAGAGTTCCACCTCAGGTATTAATGTTATAGAAATTAATCTTGCTACTTCCTCTACTGATTCTTGGGTATTTGATACC[G/A]
GGTCAGTTGCTCATATATGCAAATCTTTGCAGGGGCTGAAAAGAAGTAGGAACTTAGCAAGAGGTGAAGTGGACATTCATGTTGGCAATGGAGCAAGTGT
ACACTTGCTCCATTGCCAACATGAATGTCCACTTCACCTCTTGCTAAGTTCCTACTTCTTTTCAGCCCCTGCAAAGATTTGCATATATGAGCAACTGACC[C/T]
GGTATCAAATACCCAAGAATCAGTAGAGGAAGTAGCAAGATTAATTTCTATAACATTAATACCTGAGGTGGAACTCTTTCCATCCTACTGCTTCTGCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 13.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 78.40% | 21.20% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 45.60% | 54.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 86.10% | 13.40% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 73.90% | 25.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113429006 | G -> A | LOC_Os11g23750.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.757; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113429006 | NA | 3.06E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 4.13E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 3.69E-14 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 1.47E-10 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | 8.98E-06 | NA | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | 8.39E-06 | 3.13E-12 | mr1902 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 8.72E-11 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 1.80E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 5.43E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113429006 | NA | 2.53E-07 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |