\
| Variant ID: vg1113313944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13313944 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 107. )
ATACCCTCTACATCCGGTCTACGGGTATCACCCGTCGACAGTGGCGCGCCAGGTAGGGGGACTTGGTGCTCAAGGTTCTACTACTATGTCATCCAGCTTC[A/G]
TCGACAACAACGTCAACACCAACCTCAACCAGGTATTTCCTGCTTCACCTCTGGTGTGGACTCAAGTCGGTGAAATCGTCTTCCCGGTTTACACCATGAT
ATCATGGTGTAAACCGGGAAGACGATTTCACCGACTTGAGTCCACACCAGAGGTGAAGCAGGAAATACCTGGTTGAGGTTGGTGTTGACGTTGTTGTCGA[T/C]
GAAGCTGGATGACATAGTAGTAGAACCTTGAGCACCAAGTCCCCCTACCTGGCGCGCCACTGTCGACGGGTGATACCCGTAGACCGGATGTAGAGGGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 5.30% | 94.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113313944 | A -> G | LOC_Os11g23140.1 | upstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:47.56; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1113313944 | A -> G | LOC_Os11g23120.1 | downstream_gene_variant ; 4610.0bp to feature; MODIFIER | silent_mutation | Average:47.56; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1113313944 | A -> G | LOC_Os11g23130.1 | downstream_gene_variant ; 2036.0bp to feature; MODIFIER | silent_mutation | Average:47.56; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1113313944 | A -> G | LOC_Os11g23130-LOC_Os11g23140 | intergenic_region ; MODIFIER | silent_mutation | Average:47.56; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113313944 | NA | 9.35E-23 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.72E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.27E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.12E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.41E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 6.08E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 8.22E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 3.22E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.39E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.30E-29 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.13E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.08E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 5.00E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.08E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.16E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 4.75E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.51E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.02E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 1.56E-94 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 3.98E-09 | mr1806 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.29E-34 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113313944 | NA | 2.60E-131 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |