Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113127725:

Variant ID: vg1113127725 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13127725
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGCAGTAAACAGCATTAACAAGACTTTTAGTTGCTCAGGGTCATTTTGTAAAGACGATCCTAGAGCTACACAGTGTTATTAATCAAGGCCGTGAACCC[G/A]
CACAAACCTGCCTTAACCCAAGACCTACGATGATTCAGACTAAACTGGCAACCAGACCTGGGTCCCAGCTCATCCCAAGCCAACCCTGGCCAACCATTCC

Reverse complement sequence

GGAATGGTTGGCCAGGGTTGGCTTGGGATGAGCTGGGACCCAGGTCTGGTTGCCAGTTTAGTCTGAATCATCGTAGGTCTTGGGTTAAGGCAGGTTTGTG[C/T]
GGGTTCACGGCCTTGATTAATAACACTGTGTAGCTCTAGGATCGTCTTTACAAAATGACCCTGAGCAACTAAAAGTCTTGTTAATGCTGTTTACTGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	2.10%	3.13%	34.77%	NA
All Indica	2759	36.00%	3.60%	5.18%	55.31%	NA
All Japonica	1512	95.80%	0.10%	0.20%	3.97%	NA
Aus	269	88.10%	0.00%	0.74%	11.15%	NA
Indica I	595	16.10%	2.40%	5.38%	76.13%	NA
Indica II	465	61.10%	0.40%	2.58%	35.91%	NA
Indica III	913	30.90%	5.00%	5.81%	58.27%	NA
Indica Intermediate	786	42.00%	4.60%	5.85%	47.58%	NA
Temperate Japonica	767	97.30%	0.10%	0.39%	2.22%	NA
Tropical Japonica	504	92.50%	0.00%	0.00%	7.54%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	71.10%	1.10%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113127725	G -> A	LOC_Os11g22810.1	downstream_gene_variant ; 456.0bp to feature; MODIFIER	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1113127725	G -> A	LOC_Os11g22820.1	downstream_gene_variant ; 35.0bp to feature; MODIFIER	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1113127725	G -> A	LOC_Os11g22830.1	downstream_gene_variant ; 3432.0bp to feature; MODIFIER	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1113127725	G -> A	LOC_Os11g22840.1	downstream_gene_variant ; 4621.0bp to feature; MODIFIER	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1113127725	G -> A	LOC_Os11g22810-LOC_Os11g22820	intergenic_region ; MODIFIER	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1113127725	G -> DEL	N	N	silent_mutation	Average:30.857; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113127725	NA	7.69E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113127725	NA	7.84E-07	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113127725	NA	8.91E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113127725	NA	5.73E-07	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113127725	NA	2.75E-08	mr1919	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113127725	NA	8.50E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251